Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: Calbindin 2 (CALB2) Regula 5-fluorouracilo Sensibilidad en el cáncer colorrectal mediante la modulación de la intrínseca apoptótica Pathway
PLOS ONE: Calbindin 2 (CALB2) Regula 5-fluorouracilo Sensibilidad en el cáncer colorrectal mediante la modulación de la intrínseca apoptótica Pathway

2014/12/20


Extracto

El papel de la proteína de unión de calcio, Calbindin 2 (CALB2), en la regulación de la respuesta de cáncer colorrectal (CRC) las células a 5-fluorouracilo (5-FU) se investigó. Real-time RT-PCR y Western blot reveló que CALB2 ARNm y la expresión de la proteína se redujeron regulado en líneas celulares HCT116 CRC isogénicas p53 de tipo salvaje y nulos p53 tras 48 h y 72 h de tratamiento con 5-FU. Por otra parte, la apoptosis inducida por 5-FU se redujo significativamente en líneas celulares de CRC HCT116 y LS174T en el que la expresión CALB2 había sido silenciados. Investigaciones posteriores revelaron que CALB2 trasladadas a la mitocondria después del tratamiento con 5-FU y que la pérdida inducida por 5-FU de potencial de membrana mitocondrial (Δψ
m) fue abrogada en las células CALB2 silenciados. Por otra parte, el silenciamiento CALB2 disminuyó inducida por 5-FU citocromo cy SMAC liberación de la mitocondria y también disminuyó la activación inducida por 5-FU de las caspasas 9 y 3/7. Es de destacar que co-silenciamiento de XIAP se sobrepuso a 5-FU resistencia en células CALB2 silenciados. En conjunto, estos resultados sugieren que, tras tratamiento con 5-FU en líneas celulares de CRC, CALB2 está implicado en la inducción de apoptosis a través de la vía mitocondrial intrínseca. Esto indica que CALB2 puede ser un importante mediador de la muerte celular inducida por 5-FU. Por otra parte, la baja regulación de CALB2 en respuesta a 5-FU puede representar un mecanismo intrínseco de resistencia a este fármaco contra el cáncer

Visto:. Stevenson L, Allen WL, Proutski I, Stewart G, L Johnston, McCloskey K, et al. (2011) Calbindin 2 (CALB2) Regula 5-fluorouracilo Sensibilidad en el cáncer colorrectal mediante la modulación de la ruta apoptótica intrínseca. PLoS ONE 6 (5): e20276. doi: 10.1371 /journal.pone.0020276

Editor: Andrei L. Gartel, Universidad de Illinois en Chicago, Estados Unidos de América

Recibido: 14 Diciembre, 2010; Aceptado: 28 de abril de 2011; Publicado: 24 de mayo de 2011

Derechos de Autor © 2011 Stevenson et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Financiación:. La financiación recibido de Investigación del cáncer del Reino Unido (C212 /A7402); e Investigación y Desarrollo Oficina de Irlanda del Norte, Departamento de Salud, Servicios Sociales y Seguridad Pública (RRG /3261/05, RRG 6,42). Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:. Los autores han leído la política de la revista y tienen los siguientes conflictos: el profesor Patrick Johnston es Fundador y director de Almac Diagnostics, Craigavon, Reino Unido. Esto no altera la adhesión de los autores a todas las políticas de PLoS ONE en los datos y materiales de uso compartido.

Introducción

El cáncer colorrectal (CCR) es la segunda causa principal de muertes relacionadas con cáncer en Europa y los EE.UU. 5-fluorouracilo (5-FU) regímenes de quimioterapia siguen siendo el tratamiento estándar para la CRC, tanto en el adyuvante y los ajustes avanzados de la enfermedad. Sin embargo, las tasas de respuesta al tratamiento con 5-FU son entre un 10-20% en enfermedad metastásica [1]. La combinación de 5-FU con el inhibidor de topoisomerasa I, irinotecan (CPT-11), o el agente que daña el ADN, oxaliplatino, ha mejorado significativamente las tasas de respuesta de hasta el 50% [2] - [3]. agentes novedosos, como los anticuerpos monoclonal cetuximab, panitumumab (crecimiento epidérmico inhibidores del receptor del factor), y bevacizumab (un inhibidor del factor de crecimiento endotelial vascular) también han demostrado efectos beneficiosos cuando se combina con la quimioterapia [4] - [6]. A pesar de esto, el pronóstico para la mayoría de los pacientes con CRC avanzado sigue siendo pobre debido a la quimiorresistencia intrínseca o adquirida. Por lo tanto, se requiere la identificación de las moléculas de señalización implicadas en la mediación de la respuesta de CRC a 5-FU para determinar los mecanismos subyacentes de resistencia a 5-FU.

Calbindin-2 (CALB2, también conocido como calretinina) es una 29 kDa de calcio (Ca
2 +) proteína de unión de la familia EF-mano [7], que es una familia de proteínas que contienen Ca
2 + unión a motivos compuestos de dos hélices (e y F). Ca
2 + inducida por cambios conformacionales sugieren que CALB2 es probable que pertenecen a un grupo de Ca
2 + sensor de proteínas de esta familia [8]. En los seres humanos, CALB2 se expresa principalmente por ciertas células del sistema nervioso, sino que también se puede encontrar en las células de ovario [9]. las células epiteliales del colon normales no expresan CALB2, pero se encuentran en carcinomas de colon [10], las líneas celulares derivadas de tumores primarios de colon [11] y es un marcador de diagnóstico para los mesoteliomas [12] - [13]. El papel de CALB2 en la modulación de la excitabilidad neuronal se ha demostrado de forma consistente [14]. Sin embargo, la función fisiológica de CALB2 en células de cáncer aún no se ha dilucidado.

Ca
2 + ha sido identificado como un mensajero que coordina las interacciones endoplasmático retículo -mitochondrial (ER) que regulan la apoptosis [15]. Hay muchos tipos de estrés celular se sabe que inducen Ca
2 + liberación de la ER y la posterior Ca
2 + afluencia en la mitocondria que resulta en la pérdida de potencial de membrana mitocondrial seguida de la liberación del citocromo c y SMAC [16]. La inducción de estrés ER También se ha informado para mejorar la quimioterapia sensibilización [17]. Mitocondrial Ca
2 + dinámicas también están involucrados en la regulación del metabolismo energético celular y en procesos tales como la motilidad celular y la liberación de neurotransmisores. Por lo tanto, la regulación de Ca
2 + liberación está bajo un estricto control, y muchos Ca
2 + proteínas de unión a, como CALB2, puede funcionar aguas abajo de la ER Ca
2 + en libertad para modular la apoptosis u otro las funciones celulares.

Un estudio de microarrays de ADN llevados a cabo por nuestro grupo utilizando la HGU133 más 2,0 array (Affymetrix, Reino Unido) examinaron los perfiles de expresión de p53
+ /+ células HCT116 CRC tratados con 5-FU [ ,,,0],18]. En ese estudio, CALB2 fue identificado como un nuevo potencial regulador de la respuesta de 5-FU. El objetivo de este estudio fue investigar el mecanismo por el cual regula la respuesta CALB2 5-FU en células CRC.

Materiales y Métodos

Reactivos

5-FU fue adquirido de Sigma Chemical Co. (St. Louis, MO). Las soluciones madre se prepararon en PBS estéril y se almacenaron a 4 ° C antes de su uso. El anticuerpo CALB2 se adquirió de Chemicon International (Temecula, CA). Poli (ADP-ribosa) polimerasa anticuerpo (PARP) se adquirió de PharMingen (San Diego, CA, EE.UU.). anticuerpos Smac /DIABLO y citocromo c se compraron de BD Biosciences (Oxford, UK). El citocromo c oxidasa unidad sub IV (Cox IV) y el inhibidor unido a X de la proteína de apoptosis (XIAP) anticuerpos se adquirieron de Cell Signaling Technology, Inc (Danvers, MA, EE.UU.). anticuerpo alfa-tubulina se adquirió de Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, EE.UU.). GAPDH se adquirió de AbD Serotec (Kidlington, UK). yoduro de propidio se adquirió de Sigma (Poole, Reino Unido) y FITC-anexina V fue adquirido de BD biociencias (Oxford, UK). Un inhibidor de pan-caspasa, (OMe) -FMK Z-VAD, se adquirió de Calbiochem (Darmstadt, Alemania) |
Cultivo de células

HCT116 parental isogénica y p53
-. /- y Bax
- /- CRC líneas celulares fueron amablemente proporcionados por el profesor Bert Vogelstein (Universidad Johns Hopkins, Baltimore, MD). La línea celular fue adquirido de LS174T ATCC® (CL-188 ™). Las líneas de células HCT116 se mantuvieron en medio de McCoy 5A (Invitrogen, Reino Unido) y la línea celular LS174T se mantuvieron en Eagle modificado por Dulbecco (Invitrogen, Reino Unido). El medio se suplementó con 10% de suero de ternera fetal dializado, 50 mg /ml de penicilina-estreptomicina, 2 mM L-glutamina y piruvato de sodio 1 mM y se incubó en 5% de CO
2 a 37 ° C.

la viabilidad celular de ensayo

viabilidad celular se determinó mediante el uso de un 3- (4, 5-dimetiltiazol-2-il) -2, 5-difenil bromuro de tetrazolio (MTT, Sigma) ensayo como se describe anteriormente [19].

en tiempo real el análisis RT-PCR

el ARN total se aisló utilizando RNA STAT-60 reactivo (Biogénesis, Poole, Reino Unido) según las instrucciones del fabricante. La transcripción inversa se llevó a cabo con 8 g de ARN usando un virus de la leucemia murina de Moloney (M-MLV) kit de transcripción inversa basado (Invitrogen, Reino Unido) según las instrucciones del fabricante. amplificación PCR con transcripción inversa (RT-PCR) en tiempo real se llevó a cabo como se describe anteriormente [18]. Primer secuencias fueron los siguientes: CALB2 (hacia adelante) 5'-GCAGAGCTGGCGCAGATC- 3 ', CALB2 (inverso) 5'-GCTCATCGTACGGCCGGTTCG- 3'; GAPDH (avance) 5 '-ACAGTCAGCCGCATCTTCTT- 3' y GAPDH (marcha atrás) 5 '- GACAAGCTTCCCGTTCTCAG -3'. La expresión génica se normalizó a la expresión del gen de referencia GAPDH. los valores de expresión finales se presentan en relación con el control de tiempo con ajuste sin tratar.

se realizaron Western Blot

transferencias de Western como se describe anteriormente [19]. La inmunodetección se realizó utilizando anticuerpos monoclonales de ratón primaria contra CALB2, PARP, Smac, el citocromo c, XIAP, α-tubulina o GAPDH en combinación con anticuerpo de oveja anti-ratón de rábano peroxidasa conjugado (Amersham, Little Chalfont, Buckinghamshire, Inglaterra). Se utilizó un anticuerpo policlonal de conejo contra Cox IV en conjunción con un anti-anticuerpo secundario de conejo de burro (Amersham). La señal fluorescente se detectó usando el sistema de detección de quimioluminiscencia Super Señal (Pierce, Rockford, IL), de acuerdo con las instrucciones del fabricante.

proteína de transferencia de Western cuantificación

Los valores de densitometría de las bandas de proteínas fueron adquiridas mediante el sistema de documentación nave sistemas ChemiDoc-XRS (Bio-Rad Laboratories, Inc.). Las bandas fueron luego analizados utilizando el software de análisis Cantidad One®1-D (Bio-Rad Laboratories, Inc., versión 4.5.2).

Análisis de subG1 /G0

contenido de ADN de las células se evaluó por tinción con yoduro de propidio (PI) como se describe anteriormente [18]. Medidas y análisis se realizaron en un flujo FACS Calibur citómetro con el programa informático CellQuest (BD Biosciences, San Diego).

análisis FITC anexina V /yoduro de propidio

Las células se recogieron y se analizaron de acuerdo con el fabricante de instrucciones (BD Biosciences, Oxford, Reino Unido). En pocas palabras, los niveles de apoptosis se calcula como la suma de FITC-anexina V positiva /negativa de propidio yoduro de (a principios de apoptosis) y FITC-anexina V yoduro positivo /propidio positivo (finales de la apoptosis) población de células. Las mediciones y análisis se realizaron en un flujo FACS Calibur citómetro con el programa informático CellQuest (BD Biosciences, San Diego).

membrana mitocondrial análisis del potencial

Para determinar la pérdida de potencial de membrana mitocondrial (Δ
ψ

m), las células fueron incubadas con 25 nM tetrametilrodamina, éster etílico percholate (TMRE) a 37 ° C durante 15 min y se recogió por tripsinización. Las células se sedimentaron por centrifugación a 800
g
durante 5 min a 4 ° C y se resuspendieron en 0,5 ml de PBS. Medición y análisis se realizaron en un flujo FACS Calibur citómetro con el programa informático CellQuest (BD Biosciences, San Diego).

siRNA transfección

El CALB2 focalización (siCALB2) y no director de control (SC) construcciones de siRNA se adquirieron de Dharmacon Inc. (Chicago, IL). La construcción de secuencias utilizadas fueron siCALB2 GGCUCUGGCAUGAUGUCAAdTdT (sentido) y UUGACAUCAUGCCAGAGCCdTdT (antisentido). Las secuencias SC constructos utilizados fueron UUCUCCGAACGUGUCACGUdTdT (sentido) y ACGUGACACGUUCGGAGAAdTdT (antisentido). Una secuencia de siRNA dirigido CALB2 4 adicionales fueron adquiridos de Qiagen: siCALB2_5 (SI02660980), siCALB2_6 (SI03190824), siCALB2_7 (SI04157790) y siCALB2_8 (SI04267697). siRNA prediseñado para XIAP se adquirió de señalización Cell Technology (Danvers, MA, EE.UU.). transfecciones siRNA se realizaron con el reactivo de Oligofectamine (Invitrogen) según las instrucciones del fabricante. Después de 5 h, las células se trataron con parental ~IC
60 (72 h) de dosis de 5-FU (5 M para HCT116 y 20 mM para LS174T). Las células se recogieron después de 72 h de tratamiento con 5-FU antes del análisis por citometría de flujo y transferencia de Western.

Sub-celular fraccionamiento

Las células se recogieron por centrifugación, se lavaron en 1 ml de hielo-frío tampón de aislamiento mitocondrial (manitol 200 mM, sacarosa 70 mM, 1 mM de etilenglicol bis (α-aminoetiléter) -
N
,
N
,
N
1 | ,
N
1
, ácido tetraacético, HEPES 10 mM, 0,5 mg /ml de albúmina de suero bovino; pH 7,4) antes de Dounce homogeneización. Los restos celulares se recogieron por centrifugación a 800
g
para 10 min. la fracción mitocondrial se sedimentó por centrifugación a 10.000
g
para 10 min. El sobrenadante que contiene la fracción citosólica se transfirió a un tubo nuevo y el sedimento mitocondrial se resuspendió en 50 l de tampón RIPA (50 mM Tris pH 7,4, NaCl 150 mM, EDTA 5 mM, 1% Triton-X100, 0,1% SDS) que contiene proteasa cóctel inhibidor (Roche Diagnostics, Mannheim, Alemania).

caspasa activación ensayos

la activación de caspasa se midió usando caspasa 3/7 Glo, 8 y 9 ensayos (Promega) de acuerdo con las instrucciones del fabricante.

el análisis estadístico

los resultados se resumieron como media ± error estándar de la media (SEM) de 3 experimentos independientes. La significación estadística de los datos fue probada usando un ANOVA de 2 vías (GraphPad PRISM versión 5.01).

Microarray análisis

El HCT116 sublínea 5-FU-resistentes fue generada en nuestra de laboratorio como se describe anteriormente [20]. HCT116 células parentales y HCT116 5-FU resistentes a las células hijas fueron tratadas con 5 mM de 5-FU durante 24 h para identificar los genes que son expresados ​​diferencialmente. ARN total fue aislado de los
in vitro
experimentos utilizando el reactivo RNA STAT-60 total de aislamiento de ARN (Tel-Test) de acuerdo con las instrucciones del fabricante. El ARN total (5 mg) fue enviado a Almac Diagnostics para la síntesis de ADNc, ARNc síntesis, la fragmentación, y la hibridación en la patología colorrectal matriz específica (DSA, Almac Diagnostics) microarrays. Todos los
in vitro
ensayos in se llevaron a cabo por triplicado. Todos los datos de microarrays es compatible con MIAME y todos los datos en bruto ha sido depositado en una base de datos compatible con MIAME (número de acceso ArrayExpress: E-MEXP-1691)

Generación de listas de genes

Inicialmente cada matriz era. normalizada a la intensidad de señal media de todas las matrices. Para las matrices tratadas con fármaco, el 24 h 5-FU muestras tratadas se normalizaron luego a las muestras de control sin tratar. En el caso del experimento basal, las matrices de 5-FU-resistentes se normalizaron a las matrices de los padres HCT116. Todos los datos de microarrays (E-MEXP-1691) se filtró a continuación mediante los siguientes criterios: Affymetrix llamadas bandera (P /M en todas las muestras), Cruz de Gene error del modelo (base promedio /proporcional de corte), cambio veces (1,5 veces ) y la prueba t (p & lt; 0,05), sólo los genes que pasan los 4 filtros se retienen y se usan como los genelists de trabajo final. Tres
in vitro fueron creados en
genelists: 5-FU-inducible en los padres, 5-FU-inducible en 5-FU-resistentes y constitutivamente desregulado en 5-FU resistentes

Identificación de. vías asociadas con 5-FU-resistencia

se utilizó función de la vía KEGG dentro Genespring GX (v7.3.1) para identificar las vías desreguladas que pasan por un cambio de 1,5 veces y t-test (p & lt; 0,05) de la micromatriz
in vitro
genelists en.

Asociación de expresión CALB2 con la respuesta clínica

Hemos descargado los datos de expresión CALB2 de conjuntos de datos de microarrays pública. software GraphPad Prism 5 se utilizó para generar curvas de supervivencia de Kaplan-Meier en base a la expresión mediana CALB2 a través de cada etapa del tumor o puesta en escena combinada. Estos conjuntos de datos incluyen una cohorte CRC (GSE12945; PMID: 19399471) de 62 pacientes (13 etapa 1, 23 fase 2, 21 etapas 3 y 5 en estadio IV) sometidos electiva de resección estándar oncológica [21] y una cohorte de cáncer de mama (GSE9893; PMID: 18347175) de 132 pacientes tratadas con tamoxifeno) [22]

resultados

CALB2 expresión en las células HCT116 es el regulado por 5-FU tratamiento

a antes. estudio de microarrays de nuestro grupo informó de la expresión génica CALB2 en la línea celular HCT116 ser regulada hasta después de 24 h de tratamiento con 5-FU en relación con un control sin tratamiento 0 h [18]. Sin embargo, otros análisis revelaron que la expresión constitutiva CALB2 aumenta con el tiempo (Fig. S1), por lo que volvieron a analizar 5-FU inducidos por cambios de mRNA en los niveles de expresión de genes CALB2 en relación con un control no tratado, el tiempo de concordancia. En contraste con nuestro estudio anterior, este método indica que el tratamiento con un ~IC
60 (72 h) Dosis (5 M) de 5-FU en realidad dado lugar a una significativa, dependiente del tiempo, la baja regulación de la expresión génica en CALB2 la línea de p53
+ /+ células HCT116 (fig. 1A). En el p53
- /- línea celular HCT116, la expresión génica CALB2 no se alteró significativamente después de 24 h de tratamiento con 5-FU, pero fue significativamente las reguladas a las 48 hy 72 h (Figura 1B.). El análisis de transferencia Western demostró que esta regulación a la baja se reflejó en una reducción de la expresión de proteínas CALB2 en 5-FU células tratadas (Fig. 1C). Estos resultados sugieren que la expresión en las células HCT116 CALB2 es sumamente regulado hacia abajo en respuesta a 5-FU tratamiento y que esta modulación no es dependiente de p53.

tiempo real cuantificación RT-PCR de los niveles de mRNA en CALB2 isogénica (A) p53
+ /+ y (B) p53
- células HCT116 siguientes 24 h, 48 hy 72 h de tratamiento con 5-FU (dosis parental ~IC60
(72 h) de 5 - /M). factor de cambio en los valores de expresión son en relación con el control de tiempo con ajuste sin tratar. Las barras de error representan la media ± SEM, NS: ninguna diferencia significativa, ** p & lt; 0,01, *** p & lt; 0,001. (C) Análisis de transferencia Western de CALB2 en líneas celulares HCT116 tras 72 h 5-FU (5 mM) de tratamiento y de densitometría correspondiente de datos de expresión CALB2 respecto al control GAPDH de carga.

5-FU indujo baja regulación de CALB2 es independiente de caspasas

para determinar si la disminución de la proteína CALB2 en respuesta a 5-FU era dependiente de caspasas, HCT116 células parentales fueron tratados con un ~IC
60 (72 h ) dosis (5 M) de 5-FU solo o en combinación con una dosis de 10 mM de un inhibidor de pan-caspasa (Z-VAD) durante 72 h. La inhibición de la actividad de la caspasa después del tratamiento Z-VAD se validó usando un ensayo de actividad de la caspasa 3/7-específica (Fig. 2A). 5-FU tratamiento significativamente (p & lt; 0,05) el aumento de la caspasa 3/7 por actividad ~ 4 veces, en comparación con los controles no tratados, y esto fue completamente abrogada por Z-VAD. Es importante destacar que, Z-VAD co-tratamiento no inhibió 5-FU inducida por la baja regulación de la expresión génica CALB2 (Fig. 2B) o expresión de la proteína (Fig. 2C), lo que indica que CALB2 baja regulación no es dependiente de caspasa.

p53
+ /+ células HCT116 se trataron con una dosis de 5-FU solo o combinado con una dosis de 10 M de inhibidor de pan-caspasa Z-VAD ~IC60
(72 h) (OMe ) -FMK (Z-VAD) durante 72 h (3/7 actividad a) la caspasa se cuantificó usando un ensayo basado en indicador de luciferasa. Los valores son RFU en relación con la viabilidad celular outs lectura, según lo determinado por MTT. (B) Real-time RT-PCR cuantificación de mRNA CALB2 (factor de cambio en relación con el control no tratado, el tiempo de concordancia). (C) Análisis de transferencia Western de la expresión CALB2 y los correspondientes datos de densitometría de expresión CALB2 con respecto al control GAPDH carga.

silenciamiento CALB2 confiere resistencia a 5-FU

Desde abajo es CALB2 regulada después del tratamiento con 5-FU, se investigó su papel en la mediación de 5-FU-respuesta. Se utilizó un enfoque de silenciamiento de genes para determinar la función de CALB2 en la apoptosis inducida por 5-FU. CALB2 tumbar de siRNA fue confirmado por Western blot (Fig. 3A). siRNA mediada por silenciamiento de la expresión CALB2 se mejoró aún más por 5-FU co-tratamiento, muy probablemente debido a la supresión de CALB2 mRNA en respuesta a 5-FU tratamiento (Fig. 1A). PARP división, un indicador de la muerte celular, se observó en el siRNA-transfectadas de control p53 células
+ /+ HCT116 después del tratamiento con 5-FU. Esto fue completamente abrogada en las células CALB2 silenciados, lo que indica la reducción de la muerte inducida por 5-FU. Estos resultados fueron apoyados por citometría de flujo de datos que indica que el nivel de apoptosis inducida por 5-FU se redujo significativamente (p & lt; 0,05) a partir de ~ 30% en las células de control siRNA de ~ 17% en el p53 CALB2-silenciado
células + /+ HCT116 (Fig. 3B). En el p53
- /- línea celular HCT116, la apoptosis inducida por 5-FU también se redujo significativamente (p & lt; 0,05), de ~ 14% en las células de control de siRNA de ~ 9% en las células CALB2-silenciado (Fig . 3C). La reducción de la sensibilidad de p53
- /- células HCT116 a 5-FU se ha señalado anteriormente por nuestro grupo y otros [23], [24]. Se observaron efectos similares en otra línea celular CRC, LS174T, donde la apoptosis se incrementó significativamente después de un
60 dosis ~IC (72 h), de 20 M 5-FU y CALB2 silenciamiento reduce significativamente este (Figura 3D, p. & lt; 0,01 ). CALB2 tumbar fue confirmada por Western blot (Fig. 3D recuadro) y como en las líneas celulares HCT116, los niveles de proteína CALB2 fueron regulados hacia abajo después del tratamiento con 5-FU. Para descartar los efectos fuera de la meta de la CALB2-siRNA dirigidos, se utilizó la anexina /PI citometría de flujo para determinar el efecto de un adicional de 4 secuencias de siRNA CALB2-focalización sobre la apoptosis inducida por 5-FU en el p53
+ /+ células HCT116 (Fig. 3E). Se observó una reducción significativa de la apoptosis inducida por 5-FU con todo 4 CALB2 adicional siRNA secuencias y CALB2 silenciamiento se confirmó por análisis de transferencia Western (inserción).

(A) análisis de transferencia de Western de CALB2 y PARP en el p53 línea celular
+ /+ HCT116 después de la transfección con siRNA control (-) o CALB2 de metas de siRNA (+) y 72 h de co-tratamiento con ~IC60
(72 h), la dosis de 5-FU. GAPDH se utilizó como control de carga. Yoduro de propidio fluya el análisis de citometría que muestra el porcentaje de población de células en el sub-G1 /G0 para (B) p53 (C) p53
+ /+ y
- /- las células HCT116 después de la transfección con siRNA control (SC) o CALB2 siRNA dirigidos (siCALB2) y 72 h de co-tratamiento con 5 mM de 5-FU. (D) Anexina V /yoduro de propidio flujo análisis de citometría de la línea celular CRC LS174T después de la transfección con siRNA control (SC) o CALB2 siRNA dirigidos (siCALB2) y 72 h de co-tratamiento con ~IC60
(72 h) dosis de 5-FU (20 M). ** P & lt; 0,01, barras de error representan la media ± SEM. (Recuadro) Western blot de la expresión CALB2 en LS174T. GAPDH se utilizó como control de carga. (E) p53
+ células /+ HCT116 después de la transfección con siRNA control (SC), CALB2 siRNA dirigidos (siCALB2) o secuencias adicionales CALB2 de metas de siRNA (siCALB2_5, siCALB2_6, siCALB2_7 y siCALB2_8) y 72 h de co-tratamiento con 5 M 5-FU. (Recuadro) Western blot de la expresión CALB2 tras 72 h de la transfección con siRNA control (SC) o CALB2 orientación siRNAs en células p53
+ /+ HCT116. α-tubulina se utilizó como control de carga.

resistencia a 5-FU se asocia con la desregulación de Ca
2 + señalización

La identificación del papel de CALB2 en la mediación apoptosis 5-FU inducida junto con su Ca
2 + propiedad de enlace nos llevó a investigar el efecto de 5-FU en Ca
2 + señalización en general. experimentos perfil transcripcional se llevaron a cabo en HCT116 células hijas de los padres y el 5-FU resistentes a las líneas de tratamiento previo y posterior con 5 mM de 5-FU durante 24 h. el análisis de microarrays identificado 1389 genes en las células de los padres HCT116 y 922 genes en las células hijas 5-FU-resistentes que se han alterado (≥1.5 veces, p & lt; 0,05) después del tratamiento con 5-FU. Además, se identificaron 1329 genes como constitutivamente alterado (≥1.5 veces, p & lt; 0,05) entre las células de los padres HCT116 y las células hijas 5-FU-resistentes. Los genelists resultantes se utilizan para análisis de vías, utilizando la función de vía KEGG dentro Genespring GX (v7.3.1). Pathway análisis identificó 60 vías en las células de los padres HCT116 y 24 vías en las células hijas 5-FU-resistentes que se han alterado (≥1.5 veces, p & lt; 0,05) después de 24 h de tratamiento 5 M 5-FU. Además, se identificaron 49 vías como constitutivamente alterado (≥1.5 veces, p & lt; 0,05) entre las células de los padres HCT116 y las células hijas 5-FU-resistentes (Tabla S1). Los resultados de la vía de análisis demostraron que 11 vías fueron comúnmente alterados en cada una de las tres genelists (Tabla 1). De particular relevancia para este estudio fueron el Ca
2 + señalización y vías de apoptosis, que fueron alterados en tanto las células parentales y 5-FU-resistentes después del tratamiento con 5-FU y también basalmente desregulado en las células 5-FU-resistentes en comparación con los parentales. Esto sugiere que el Ca
2 + señalización y la apoptosis puede ser mediadores de 5-FU sensibilidad /resistencia en esta configuración.

silenciamiento CALB2 abroga la apoptosis inducida por 5-FU a través de la vía intrínseca

Dado el Ca
2 + propiedades de CALB2 y el papel integral de Ca unión
2 + señalización en la vía apoptótica intrínseca, el papel de CALB2 en la mediación de 5-FU inducida, la apoptosis mitocondrial regulado se procedió a investigar. El examen de las fracciones subcelulares HCT116 demostraron que en las células no tratadas, CALB2 se encuentra en el citosol y no se asoció con la mitocondria (Fig. 4A). Sin embargo, tras 72 h de tratamiento 5-FU, los niveles de CALB2 en el citosol disminuyeron mientras que los niveles CALB2 mitocondriales aumentaron, lo que indica la translocación CALB2 inducida por 5-FU a las mitocondrias. El análisis de transferencia Western de α-tubulina y COXIV demostró la pureza de estas fracciones subcelulares (Fig. S2). Estos resultados demuestran una asociación entre inducible CALB2 y la mitocondria en respuesta al tratamiento 5-FU.

(A) análisis de transferencia de Western de CALB2 en el mitocondrial y fracciones citosólicas de células p53
+ /+ HCT116 siguiente la transfección con el control de siRNA (-) o CALB2 de metas de siRNA (+) y 72 h de co-tratamiento con 5-FU. Cox IV se utilizó como control de carga mitocondrial y se utilizó a-tubulina como control de carga citosólica. (B) Análisis de citometría de flujo TMRE que muestra el porcentaje de p53 isogénica
+ /+ y p53
- /- las células HCT116 con pérdida de Δψ
m (% despolarizado) después de la transfección con el control de siRNA (sc) o CALB2 siRNA dirigidos (siCALB2) y 72 h de co-tratamiento con 5 mM de 5-FU. ** P & lt; 0,01, barras de error representan la media ± SEM. (C) TMRE citometría de flujo experimento repetido con una segunda secuencia de siCALB2. (D) Western blot de C SMAC y en el citocromo mitocondrial y citosólica fracciones de 5-FU tratada p53 células
+ /+ HCT116. Cox IV y α-tubulina se utilizaron como controles de carga. (E) Los ensayos de actividad caspasa en las células p53
+ /+ HCT116. valores de RFU se normalizaron a la viabilidad celular (ensayo MTT) y se expresaron como factor de cambio RFU en las células CALB2 silenciado en relación con el control de siRNA (SC) células. Las barras de error representan la media ± SEM. (F) anexina V /yoduro de propidio flujo de análisis de citometría de p53 de apoptosis células
+ /+ HCT116 siguiente CALB2 o XIAP silenciar solo o en combinación. Las células se co-tratadas con 5 mM 5-FU durante 72 h como se indica. * P & lt; 0,05, ** p & lt; 0,01, barras de error representan la media ± SEM. (Recuadro) análisis de transferencia Western de la expresión de XIAP después de la transfección con 10 nM siRNA de control (-) o 10 nM XIAP siRNA dirigidos (+). GAPDH se utilizó como control de carga.

La asociación entre CALB2 y la mitocondria tras el tratamiento 5-FU nos llevó a investigar más a fondo el papel de la vía apoptótica intrínseca en la resistencia a 5-FU. El miembro de la familia Bcl-2 pro-apoptóticos, Bax es un iniciador importante de la apoptosis mitocondrial mediada. tanto, nuestro estudio HCT116 células nulas Bax parentales y isogénicas después del tratamiento con la dosis parental ~IC
60 (72 h) de 5-FU durante 72 h. El parental ~IC
60 (72 h), la dosis de 5-FU provocado un aumento ~ 3 veces en la apoptosis en la línea celular parental HCT116 (p & lt; 0,01), pero no tuvo efecto significativo sobre los niveles de apoptosis en el Bax null células (datos no mostrados). Estos resultados confirman los resultados anteriores [25], [26] que Bax y la vía intrínseca de apoptosis son los principales efectores de la apoptosis inducida por 5-FU.

La pérdida de potencial de membrana mitocondrial (Δ
ψ

m) con la liberación concomitante de SMAC y el citocromo C seguido de la caspasa 9 y se observa 3/7 de activación durante la apoptosis a través de la vía intrínseca. Por lo tanto, TMRE, un tinte fluorescente para medir el potencial de membrana de las mitocondrias se utilizó para determinar Δ
ψ

m por citometría de flujo (Fig. 4B). pérdida de Δ 5-FU inducida
ψ

m, como se indica por las células no fluorescentes, se redujo significativamente (p & lt; 0,001) en el CALB2-silenciado p53
+ /+ células HCT116 . pérdida de Δ 5-FU inducida por
ψ

m también se redujo significativamente (p & lt; 0,05) en el p53 CALB2 silenciados
- - /células. Este efecto fue confirmado con una segunda secuencia CALB2 siRNA (Fig. 4C), descartando fuera de objetivo efectos de la CALB2 siRNA. Además, el análisis de transferencia Western de fracciones subcelulares reveló que la pérdida de SMAC y el citocromo c 5-FU-inducida de la fracción mitocondrial fue abrogada en las células CALB2 silenciados (Fig. 4D). Este fue concurrente con niveles reducidos de SMAC y citocromo c liberados en el citosol en respuesta a 5-FU en las células CALB2-silenciada. activación Además, inducida por 5-FU de la caspasa 9 y 3/7, como se mide por ensayos de actividad basados ​​en reportero de luciferasa, se redujo significativamente en las células CALB2-silenciado (Fig. 4E). No se observaron diferencias significativas en la activación de la caspasa 8 entre las células CALB2-silenciado y controles siRNA siguiente 72 h 5 tratamiento mu M 5-FU (datos no mostrados). Estos resultados sugieren además un papel para CALB2 en la regulación del 5-FU inducida por, vía apoptótica intrínseca.

sensibilidad de 5-FU en células CALB2 silenciados se restaura mediante la co-XIAP silenciar

La experimentos descritos anteriormente demuestran que el mantenimiento del potencial de membrana mitocondrial, la retención de SMAC y citocromo c por las mitocondrias con la reducción concomitante en la actividad de caspasa se asocian con aumento de la resistencia 5-FU en las células CALB2-silenciada, lo que sugiere la señalización disfuncional a través de la vía apoptótica intrínseca. Un estudio previo de nuestro grupo demostró que la resistencia a la apoptosis conferido por una vía apoptótica intrínseca comprometido puede ser evitado siguiendo XIAP silenciamiento. XIAP inhibe la activación de la caspasa 9 a través de su dominio BIR3 y activación de la caspasa 3 a través de su dominio BIR2. liberación Smac interrumpe la interacción de XIAP con la caspasa 9 y caspasa 3 [27], lo que lleva a la activación de estas caspasas y la posterior apoptosis. Tenemos la hipótesis de que el silenciamiento XIAP puede superar la resistencia al 5-FU causada por el silenciamiento CALB2 por la anulación del bloque de la vía apoptótica intrínseca. Por lo tanto, se investigó el efecto de la respuesta co-silenciamiento de XIAP y CALB2 en 5-FU. XIAP silenciamiento en las células HCT116 utilizando un (recuadro 4F Fig.) XIAP-siRNA dirigidos fue confirmado por Western blot. La fracción apoptótica de las células fue identificado por citometría de flujo con anexina V y yoduro de propidio. De nuevo, esto demuestra que la apoptosis inducida por 5-FU se redujo significativamente (p & lt; 0,05) en las células CALB2 silenciados (figura 4F.), Mientras que, el 5-FU inducida por la apoptosis fue significativamente mayor en las células silenciadas-XIAP (p & lt; 0,05).

El conocimiento de la salud

Heres su sesión - basal de piel de células Cancer

Esto es obviamente un caso de cáncer de células basales que

RBGH y Cáncer - una causa de Concern

What es rBGH? rBGH es sinónimo de la hormona de crecimiento

10 Los síntomas del cáncer en las mujeres

Las formas de cáncer que con más frecuencia afectan a las mu

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]