Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: Inhibidor-Sensible FGFR1 amplificación en humanos de células no pequeñas de pulmón Cancer

PLOS ONE: Inhibidor-Sensible FGFR1 amplificación en humanos de células no pequeñas de pulmón Cancer


Extracto

Antecedentes

células escamosas carcinomas de pulmón representan aproximadamente el 25% de los nuevos casos de carcinoma de pulmón y 40.000 muertes por año en los Estados Unidos. Aunque hay varias terapias dirigidas genómicamente para el adenocarcinoma de pulmón, ninguno ha sido reportado en el carcinoma de pulmón de células escamosas.

Metodología /Principales conclusiones

Utilizando el análisis de SNP gama, se encontró que una región del cromosoma 8p11-12 segmento que contiene tres genes-
WHSC1L1
,
LETM2
, y
FGFR1
-se amplifica en el 3% de los adenocarcinomas de pulmón y el 21% de los carcinomas de pulmón de células escamosas. Por otra parte, hemos demostrado que una no pequeña línea celular de carcinoma de pulmón de célula que alberga la amplificación focal de
FGFR1
depende de la actividad FGFR1 para el crecimiento celular, como el tratamiento de esta línea celular, ya sea con
FGFR1 CD - shRNAs o con inhibidores enzimáticos FGFR pequeñas moléculas específicas conduce a la inhibición del crecimiento celular.

Conclusiones /Importancia

Estos estudios muestran que
FGFR1 amplificación
es común en el cáncer de pulmón de células escamosas, FGFR1 y que puede representar una diana terapéutica prometedora en el cáncer de pulmón de células no pequeñas

Visto:. Dutt a, Ramos AH, Hammerman PS, Mermel C, J Cho, Sharifnia T, et al. (2011) Inhibidor-Sensible
FGFR1 amplificación en
humano de células no pequeñas cáncer de pulmón. PLoS ONE 6 (6): e20351. doi: 10.1371 /journal.pone.0020351

Editor: Usted Ming, Colegio Médico de Wisconsin, Estados Unidos de América

Recibido: 30 Diciembre, 2010; Aceptado: 30 de abril de 2011; Publicado: 7 Junio ​​2011

Derechos de Autor © 2011 Dutt et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Financiación:. Fuentes de financiación para este trabajo incluyen el apoyo de Novartis Pharmaceuticals, la Asociación Americana del pulmón, Unidos contra el cáncer de pulmón, el Fondo Monopoli Thomas Sarah, la Fundación marinero y Genentech a MM DC es apoyado por una beca Ramalingaswami del Departamento de Biotecnología del Ministerio de Ciencia, Gobierno de la India. P.S.H. con el apoyo de un Young Investigator Award de la Asociación Nacional de Cáncer de Pulmón. Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:. M. M. es un consultor para Novartis y recibe apoyo para investigación de Novartis, recibe apoyo para investigación de Genentech, y es un asesor y consultor de la fundación, y el titular de la equidad en la Fundación Medicina. N. G. laboratorio recibe patrocinó la investigación de Novartis. Sin embargo, esto no altera la adhesión de los autores a todas las políticas de PLoS ONE en los datos y materiales de uso compartido.

Introducción
cáncer
pulmón es la causa principal de muerte por cáncer en los países desarrollados con muertes en el año 2009 estiman en aproximadamente 160.000 en los Estados Unidos, que representa aproximadamente el 28% de todas las muertes por cáncer [1]. Cáncer de pulmón no microcítico (CPNM) representa el 75% de todos los cánceres de pulmón e incluye dos subtipos predominantes, el adenocarcinoma y el carcinoma de células escamosas (SCC), que comprenden el 40% y el 25% de NSCLC, respectivamente [2], [3] . A pesar histológico clara y distinciones biológicas, adenocarcinoma de pulmón y carcinoma de células escamosas son tratados en gran medida con los mismos agentes quimioterapéuticos con la excepción de la pemetrexed agente antifolato que está aprobado para el tratamiento del CPNM no escamoso [4].

avances significativos en el tratamiento del adenocarcinoma de pulmón se han originado a partir de análisis genómicos detallados y el despliegue de agentes dirigidos molecularmente principales que han conducido a mejoras en los resultados de los pacientes. Los ejemplos incluyen el uso del receptor del factor de crecimiento epidérmico (EGFR) inhibidores tales como gefitinib y erlotinib [5], [6], [7] para adenocarcinomas de pulmón que llevan
EGFR
mutaciones [8], [9], [ ,,,0],10], y de los inhibidores de ALK como crizotinib [11] para soportar los adenocarcinomas de pulmón
EML4-ALK
el translocaciones [12], [13].

Sin embargo, poco se sabe actualmente sobre el objeto de orientación anomalías genéticas subyacentes del cáncer de pulmón de células escamosas. Además de
TP53
mutaciones [14], los carcinomas de pulmón de células escamosas han demostrado que el puerto amplificaciones de
PIK3CA
[15],
Sox2
[16], y
EGFR
[16], así como
EGFR
variante III mutaciones [17]
DDR2
mutaciones [18] y amplificaciones raros de
PDGFRA /KIT
[ ,,,0],19], [20] y
BRF2
[21]. Un estudio reciente ha demostrado la amplificación focal de los
FGFR1
locus en el cromosoma 8p asociado con la dependencia celular en el
FGFR1
y sensibilidad a los inhibidores de FGFR [22]. En este momento no existen terapias específicas aprobadas por la FDA para el cáncer de pulmón de células escamosas.

Orientación de tirosina quinasas amplificados con anticuerpos o con inhibidores de molécula pequeña que ha dado lugar a mejoras dramáticas en las tasas de respuesta y la supervivencia global de los pacientes con cáncer cuyos tumores albergar anormalidades específicas del genoma. Las amplificaciones de
EGFR
y
erbB2
han sido reportados en una variedad de tumores malignos, incluyendo la cabeza y el cuello, esofágico, gástrico, de mama y cánceres de colon, así como NSCLC [23]. La orientación de estas tirosina quinasas, tales como el uso de cetuximab para apuntar
Hoteles en EGFR colorrectal y cáncer de cabeza y cuello [24], [25] y el uso de trastuzumab a Target
Hoteles en ErbB2 cáncer de mama [26], se ha traducido en una mejora significativa en los resultados del paciente en cada una de estas enfermedades, aunque no todos los pacientes con estas amplificaciones responden a fármacos dirigidos [27], [28], probablemente debido a alteraciones genómicas adicionales dentro del tumor que resultan en la resistencia primaria a agentes específicos [29], [30].

El tipo de crecimiento de fibroblastos receptor del factor 1 gen (
FGFR1
) es uno de los genes más frecuentemente amplificada en el cáncer humano [16 ]. El receptor del factor de crecimiento de fibroblastos (FGFR) familia de quinasas de tirosina se compone de cuatro quinasas, FGFR1, 2, 3, y 4, que juegan papel crucial en el desarrollo, y se ha demostrado que ser el objetivo de la desregulación ya sea por amplificación, mutación puntual, o translocación (revisado en [31]). Los desplazamientos que implican
FGFR3
, así como la activación de mutaciones somáticas en
FGFR3
han sido identificados en el mieloma múltiple y el cáncer de vejiga [32], [33], [34]. Nosotros y otros han identificado mutaciones activadoras en
FGFR2 Hoteles en cáncer de endometrio [35], [36]. La amplificación o activación de
FGFR1
ha sido reportado en el carcinoma oral de escamosas [37], de esófago carcinomas de células escamosas [38], cáncer de ovario [39], cáncer de vejiga [40], cáncer de próstata [41], [rhabodomyosarcoma ,,,0],42], y el cáncer de pulmón [16], [43], [44], [45], [46]. Consistente con esto, un FGFR pan-inhibidor de la tirosina quinasa se ha demostrado que bloquear la proliferación tumoral en un subconjunto de líneas celulares de NSCLC con señalización FGFR activado pero no tiene efecto en las células que no activan la vía [47].
FGFR1
ha sido identificado como el evento conductor en los carcinomas de mama y NSCLC, especialmente los carcinomas de pulmón de células escamosas, que alberga amplificaciones similares del segmento cromosómico 8p11 [22], [48]

Sobre la base de SNP matriz de análisis de número de copias de 732 muestras, nos informan de que
FGFR1
se amplifica de forma somática en el 21% de pulmón carcinomas de células escamosas en comparación con el 3,4% de los adenocarcinomas de pulmón. Validamos FGFR1 como una posible diana terapéutica, mostrando que al menos un
FGFR1
línea de células tumorales -amplified NSCLC es sensible a la inhibición enzimática FGFR y dependiente de
FGFR1
expresión para la viabilidad celular como lo demuestra tratamiento shRNA. Junto con los informes anteriores revisados ​​anteriormente, estos resultados sugieren que FGFR1 puede ser una atractiva diana terapéutica en el CPNM.

Materiales y Métodos

muestras primarias y líneas celulares de NSCLC
celular
NSCLC líneas, NCI-H1703 (escamosas), NCI-H2444 (pulmonar), NCI-H520 (escamosas), HCC95 (escamosas), NCI-1581 (carcinoma de células grandes), Calu3 (no se especifique lo contrario), NCI-H1734 (no de otro modo especificado), Colo699 (adenocarcinoma), NCI-H2170 (escamosas), NCI-H226 (escamosas), A427 (adenocarcinoma), NCI-H1563 (adenocarcinoma), NCI-H1781 (adenocarcinoma) y HCC15 (escamosas) se obtuvieron de la colección Gazdar de la FA, J. Minna, y sus colegas [49], [50], [51], a partir de ATCC (Manassas, Virginia, Estados Unidos) y /o DSMZ (Braunschweig, Alemania). Las células se mantuvieron en medio RPMI 1640 completo suplementado con 10% de suero de ternera (Gibco /Invitrogen, Carlsbad, California, Estados Unidos) y penicilina /estreptomicina (Gibco /Invitrogen). Los pares normales /tumorales de NSCLC analizados en este estudio se han descrito anteriormente [16], [20], [45], [50], [52].

SNP serie de datos de análisis

experimentos SNP serie se realizaron en 732 muestras y datos de tumor y de líneas celulares de NSCLC analizada como se describe anteriormente [16], [20], [45], [50], [52]. Se identificaron los límites de la 8p11 amplicón definido por análisis logís- [53] como se informó [52] (http://www.broadinstitute.org/tumorscape/pages/portalHome.jsf). visualización de los datos se ha realizado mediante el Integrativa Genómica Visor (http://www.broadinstitute.org/igv).

La transfección e infección

Phoenix 293T línea celular de empaquetamiento (Orbigen, San Diego, California, Estados Unidos) se transfectaron con vectores de puerta de enlace basados ​​en pBabe-Puro utilizando FuGENE® 6 reactivo de transfección (Roche, Indianapolis, Estados Unidos) para generar retrovirus de replicación incompetente. Las células diana se infectan con estos retrovirus en presencia de 8 mg /ml de polibreno. Dos días después de la infección, las células fueron tratadas con 2 mg /ml de puromicina (Sigma, St. Louis, Missouri, Estados Unidos) durante dos días. Las líneas celulares estables resultantes se utilizaron para estudios experimentales.

mediada shRNA
FGFR1
caída

shRNA vectores se obtuvieron de TRC (El Consorcio ARNi). Las secuencias diana de las construcciones shRNA son:


FGFR1
#1 (TRCN 0000121307):. AGTGGCTTATTAATTCCGATA 5'-3 '


FGFR1
#2 (TRCN 0000121308): 5'-3 GCTTGCCAATGGCGGACTCAA '


FGFR1
#3 (TRCN 0000121309):. CTTGTATGTCATCGTGGAGTA 5'-3'.


FGFR1
#4 (TRCN 0000121310): 5'-3 CAAGATGAAGAGTGGTACCAA '


FGFR1
#5 (TRCN 0000121311):. GAATGAGTACGGCAGCATCAA 5'-3'.


LETM2
#1 (TRCN 0000040243): 5'-3 CGCACCTTCTACCTGATAGAT '


LETM2
#2 (TRCN 0000040244):. 5'- CCCAGCACAAAGGAGATAGTT-3 '


LETM2
#3 (TRCN 0000040245):. CCAGTTACATCATCACCCATA 5'-3'.


LETM2
#4 (TRCN 0000040246): 5'-3 CCAGGAACTAGACTAATACAA '


LETM2
#4 (TRCN 0000040247):. GCATTGAGTGTATCAGAACTA 5'-3'.


WHSC1L1
#1 (TRCN 0000015613): 5'-3 CGAGAGTATAAAGGTCATAAA '


WHSC1L1
#2 (TRCN 0000015614):. CCATCATCAATCAGTGTGTAT 5'-3'.


WHSC1L1
#3 (TRCN 0000015615): 5'-3 CGAGAATATCATGTCCAGTTT '


WHSC1L1
#4 (TRCN 0000015616):. GCTTCCATTACGATGCACAAA 5'-3' .


WHSC1L1
#5 (TRCN 0000015617):. GCAGGGAATTGTTTGAGTCTT 5'-3 '

la secuencia se dirige el
GFP
shRNA es 5 '-GCAAGCTGACCCTGAAGTTCAT-3'. Los lentivirus se hicieron mediante transfección de células de empaquetamiento 293T con estas construcciones utilizando un sistema de tres plásmidos tal como se describe anteriormente [54]. Las células diana se incubaron con lentivirus para 6 horas en presencia de 8 mg /ml de polibreno y se dejaron en medio fresco. Las células se cultivaron durante dos días. Cincuenta microgramos de lisados ​​celulares totales preparados a partir de las líneas celulares infectadas se analizaron por transferencia Western.
Ensayos
crecimiento y la proliferación

Para los ensayos de supervivencia, 2 × 10
6 células por cada célula tumoral línea de expresar shRNAs orientación construcciones
FGFR1
,
WHSC1L1
,
LETM2
o
GFP
junto con las células no infectadas se sembraron en 3 replicados en una placa de 6 pocillos . La viabilidad celular se determinó a los 24 puntos de tiempo hora por 4 días consecutivos contando las células por medio de Beckman Coulter Vi-automático de células viabilidad celular Analizador siguiente tripano tinción de colorante azul. El porcentaje de viabilidad de las células se representó gráficamente para cada línea celular de lecturas obtenidas en el día 4 con relación al día 1.

Soft agar anclaje independiente de ensayo de crecimiento

Para los ensayos de agar blando, 2 × 10
4 células de NSCLC que expresan sh
FGFR1 Opiniones y sh
GFP
se suspendieron en una capa superior de RPMI1640 que contenía 10% de suero bovino y 0,4% de agar Select (Gibco /Invitrogen, Carlsbad, California, de los Estados Unidos) y se sembraron en una capa inferior de RPMI1640 que contiene 10% de suero bovino y 0,5% Select agar en una placa de 6 pocillos. Se añadieron PD173074 o Fiin-1 [55] tal como se describe en la parte superior de agar. Después de 3-5 semanas de incubación se contaron las colonias por triplicado. IC50 se determinaron mediante regresión no lineal utilizando el software Prism 5 (GraphPad Software).

Ensayos de citotoxicidad

En función de las curvas de crecimiento para cada línea celular, entre 800 y 2000 células de NSCLC fueron sembradas en 6 repeticiones 96- en la placa también. Un día después de la siembra, dosis crecientes de FGFR inhibidores de PD173074 o se añadieron fiin-1 y la proliferación de las células se evaluó 4 días más tarde usando el ensayo de WST-1 (Roche Applied Science). Cada punto de datos representa la media de seis pocillos replicados para cada línea de células tumorales y la concentración de inhibidor. CI50 se determinaron por regresión no lineal usando el software Prism Graphpad.

transferencias Western

La proteína total se extrajo y se separó por electroforesis en gel mediante la lisis de las células en un tampón que contiene 50 mM Tris-HCl (pH 7,4 ), NaCl 150 mM, EDTA 2,5 mM, 1% de Triton X-100, y 0,25% de Igepal. Se añadieron inhibidores de proteasa (Roche Applied Science) y los inhibidores de fosfatasa (Calbiochem) antes de su uso. Antes de cargar el gel, las muestras se normalizaron para contenido total de proteína. Total de proteína lisados ​​se hirvieron en tampón de muestra, separados por SDS-PAGE en geles de poliacrilamida al 8%, se transfirieron a una membrana de PVDF, y se sondaron durante la noche utilizando los anticuerpos primarios apropiados. Los anticuerpos utilizados para inmunotransferencia fueron: anticuerpo anti-FGFR1 (# 3472, Tecnologías de Señalización Celular, Danvers, MA, Estados Unidos), fosfo anti FRS2 Y436 (# 3861, Tecnologías de Señalización Celular, Danvers, MA, Estados Unidos), anti-fosfo -FRS2 Y196 (# 3864, Tecnologías de señalización Celular, Danvers, MA, Estados Unidos), anti-FRS2 (# SC-17841, Santa Cruz Biotechnology, Santa Cruz, CA, Estados Unidos). anti-WHSC1L1 anticuerpo monoclonal (# sc-130 009, Santa Cruz Biotechnology), anti-LETM2 anticuerpo monoclonal (# ab84626, Abcam) y anticuerpo monoclonal anti-actina (# sc-1615, Santa Cruz Biotechnology).

Análisis estadístico

Las comparaciones entre los datos de número de copia SNP gama de adenocarcinoma de pulmón (AC) y el carcinoma de células escamosas (SCC), los tumores se realizaron mediante la prueba exacta de Fisher T para calcular los valores de p de dos colas entre las muestras que albergan alto nivel amplificación, que se define como la relación de log2 & gt; 0,7 o 3,25 copias de ADN normalizados. Los valores de p & lt; 0,05. se consideraron significativos

Para determinar la CI50 para los inhibidores de FGFR, las mediciones de viabilidad celular de seis repeticiones en concentraciones variables de inhibidores se normalizaron a las células de control no tratadas. curvas de respuesta de dosis sigmoidal se ajustaron a los datos por regresión no lineal usando el software GraphPad Prism. Las desviaciones estándar se determinaron para la media de cada valor con un módulo incorporado del software.

Para los experimentos shRNA, realizados en tres repeticiones, el número de células se contó y la media y la desviación estándar se determinaron utilizando las funciones de Microsoft Excel.

resultados


FGFR1
se amplifica en el cáncer de pulmón de células no pequeñas

Hemos examinado la región genómica 8p11-12 utilizando Affymetrix SNP 250K los datos de número de copias en un conjunto de datos de informes anteriores de 732 muestras de NSCLC, (628 tumores primarios y líneas celulares 104) (Tabla S1) [16], [20], [45], [50], [52]. Se observó amplificación de alto nivel, que se define como la relación de log2 & gt; 0,7 o 3,25 copias de ADN normalizados, del segmento 8p11-12 cromosómico que abarca la
FGFR1
locus en 44 (6%) de las muestras de NSCLC (Figura 1a; Tabla S2). La mayoría (93%; 41/44) de estas amplificaciones se acontecimientos relativamente focales (& lt; 50% de la longitud de 8p cromosoma) que indica la selección preferencial de los genes diana específicos dentro de la región de amplificación [52]. El número de copias inferidos de las amplificaciones, normalizado a un número de copias de 2 para cada muestra, varió de 3,25 a 25 copias (mediana = 2,8 copias). La estimación del nivel de la región de amplificaciones focales varió de 0,47 a 112,7 Mb (mediana = 2,74 Mb) guía
(A) El número de copias en el cromosoma estima 8p11-12q brazo para 44 muestras de NSCLC (columnas;. Ordenado por la amplificación de 8p11) que tiene amplificación mayor que 3,25 copias (relación log2 de 0,7) de una colección de 732 muestras primarias y líneas celulares de NSCLC. La línea horizontal indica la región que contiene
FGFR1
,
LETM2
y
WHSC1L1
genes. La escala de color varía desde el azul (supresión) a rojo (amplificación) con el número de copias estimadas ilustradas. regiones grises representan la ausencia de datos de número de copia SNP. (B) Gráfico de barras que muestra los porcentajes de muestras que albergan 8p11-12 amplificación en adenocarcinomas de pulmón (AC) y el carcinoma de células escamosas (SCC) demuestra que
FGFR1 amplificación
se observa en SCC en mucho más alta que la frecuencia de corriente alterna. (C) la expresión de FGFR1 (panel superior) se muestra en diez células de NSCLC; ocho líneas de célula que alberga
FGFR1 amplificación
-HCC1734, HCC95, NCI-H2444, Calu3, NCI-H2077, H1703-NCI, NCI-H1581 y NCI-H520 (indicado por la barra horizontal roja abajo) -uno de células NSCLC línea de albergar la supresión de la HCC15 región (indicado por la barra horizontal azul abajo) - y tres células de NSCLC con ninguna amplificación-A427, NCI-H226, NCI-H2170 (indicado por la barra horizontal negro abajo) - utilizando actina como control de carga (que se muestra en el panel inferior).
FGFR1
estado de número de copias y la longitud de amplificación 8p11-12 determinado por SNP gama se indica a continuación células que albergan la amplificación. Es de destacar que el NCI-H2077 y NCI-1581 resultaron ser genotípicamente idénticos por las huellas dactilares de análisis.

Para identificar regiones de alteración significativa número de copias, se aplicó logís- (Genómica identificación de dianas significativo del cáncer ) [53], y se identificó una región de 170 Kb en 8p11 (38,28 a 38,45 Mb) que amplifica significativamente. Mientras que el patrón general de 8p11 amplificación fue consistente con la literatura sobre el cáncer de pulmón según lo informado, nuestro tamaño de la muestra y la resolución, siempre más poder identificar y localizar tanto a gran escala y alteraciones cromosómicas focales precisión en comparación con los informes anteriores [45], [52 ]. Los únicos genes dentro de la región de la amplificación identificado en nuestro análisis en todas las muestras fueron
FGFR1
y
LETM2
. En nuestros datos de número de copia,
WHSC1L1
se amplificó por lo general con
FGFR1
y
LETM2 gratis (41/44 muestras) pero el conjunto
WHSC1L1
gen hizo no entra en el pico de logís- (CHR8: 38,284,229-38,451,475). En concreto, tres muestras de tumores primarios con amplificada
FGFR1
y
LETM2
genes tenían puntos de ruptura dentro de amplicón
WHSC1L1
, explica la exclusión de
WHSC1L1
de la logís- pico de amplificación (Figura S1; S2 Figura). Los puntos de corte de amplicón dentro de
WHSC1L1
son consistentes con la falta de amplificación del dominio SET funcional (CHR8: 38,265,630-38,255,125) asociada con la actividad enzimática de la histona metiltransferasa del producto del gen [56]. Estos resultados no excluyen
WHSC1L1
como blanco de amplificación de 8p11, junto con
FGFR1
pero sugieren que su actividad histona metiltransferasa no es probable que estar orientadas específicamente para la amplificación.

en la comparación de los subtipos de NSCLC tumores primarios y líneas celulares, un 3,4% (20/588) de los adenocarcinomas y el 21% (12/57) de los carcinomas de células escamosas albergaron 8p11 amplificaciones, lo que indica que, si bien 8p11 se amplifica en las frecuencias apreciables a través de ambos importante NSCLC subtipos, que se amplifica preferentemente en los CE (
p Hotel & lt; 0,001, prueba exacta de Fisher) (Figura 1b). Estadísticamente no se observaron correlaciones significativas entre la presencia de 8p11 amplificaciones y parámetros clínicos disponibles, incluyendo la histología, grado de diferenciación histológica, etapa en la resección quirúrgica de los tumores y la edad, el género, el origen étnico o informado de los pacientes (Tabla S3). Además, la secuencia diana del dominio quinasa de
FGFR1
en 52 líneas celulares de cáncer y de la totalidad de
FGFR1
secuencia de codificación en tres líneas celulares (NCI-H1581, NCI-H1703, NCI-H2170 ) no reveló ninguna evidencia de mutaciones en el dominio quinasa (datos no mostrados).

Los SNP serie de datos revelaron una elevada
FGFR1
número de copias del gen en 11 líneas celulares de cáncer de 104 líneas celulares de cáncer analizado (Figura S3) con amplificaciones observadas en 36% (4/11) de las líneas de células escamosas de NSCLC ensayadas. Se examinó la expresión de proteínas FGFR1 mediante análisis de inmunotransferencia en 8 líneas primarias celulares de NSCLC que albergan focal o amplia 8p11 amplificación por encima de un log2 ratio de 1,6 o 6,0 copias de ADN normalizados (NCI-H1703, NCI-H2444, NCI-H520, NCI-1581, NCH -H2077, Calu3, NCI-H1734, y el CHC 95), 3 que tienen aproximadamente neutro
FGFR1
número de copias (NCI-2170, el NCI-H226 y A427) y 3 que albergan
FGFR1
deleción (NCI-H1781, H1563 y NCI-HCC15) mediante análisis de inmunotransferencia. Encontramos 6 de 8
FGFR1
líneas celulares de cáncer sobreexpresan amplificados FGFR1 en comparación con líneas celulares que no alberguen amplificación, con las excepciones de las células NCI-H1703 Calu3 y (figura S4; Figura 1c). En consonancia con este hallazgo, NCI-H1703, que alberga una amplificación 8p11, ha demostrado no ser dependiente de
FGFR1
[44], pero en amplificado
PDGFRA
[19], [20] . Además, se observó un elevado nivel de fosforilación del sustrato FRS2 FGFR1 en células de carcinoma de células grandes NCI-H1581 que llevan amplificación focal de
FGFR1
, pero no en células que albergan los niveles relativamente amplios de
FGFR1
amplificación (Figura S4).


se requiere FGFR1 Opiniones de supervivencia de una línea celular de NSCLC que alberga la amplificación focal

sobre la base de nuestro análisis del número de copias,
FGFR1
y
LETM2
cayeron dentro de la región definida por el logís- de la amplificación estadísticamente significativa con
WHSC11
inmediatamente adyacente. Para determinar el requisito celular de los genes en la región objeto de la amplificación, se evaluó el requisito de
WHSC1L1
,
LETM2
y
FGFR1
expresión para el mantenimiento del tumor por el agotamiento de ellas de forma individual utilizando shRNA. La transfección con cinco shRNA orientación construcciones ya sea
WHSC1L1
o
LETM2
no tuvo ningún efecto diferencial sobre la supervivencia de las células que albergan focal o amplia 8p11-12 amplificación en comparación con las células control sin la amplificación (datos no se muestra).

por el contrario, tres de cada cinco shRNA orientación construcciones
FGFR1
, todo lo cual condujo a una disminución de 3 a 5 veces en los niveles de proteína FGFR1 relación con los controles shRNA (Figura 2a), la supervivencia celular significativamente inhibido en una línea de células de NSCLC que lleva un centro de coordinación
FGFR1
amplificación (NCI-H1581; Figura 2b). shRNA construye#3 y#4, que no condujo a la caída significativa de los niveles de proteína FGFR1, no afectó a la supervivencia de las células que albergan 8p11 amplificación (Figura 2b). No hubo efectos de supervivencia observada de
FGFR1
shRNA sobre líneas de células que albergan relativamente amplio
FGFR1
amplificación (NCI-H1703, HCC95, HCC1734, Calu3; no se muestra) o sin
FGFR1
amplificación (NCI-H2170;. La figura 2c HCC15, NCI-H1563 y H1781-NCI; no presentados). En general, estos resultados sostienen que
se requiere FGFR1
expresión para la viabilidad de la línea celular de al menos un CPNM llevar un
FGFR1 amplificación.


(A) Efectos de cinco
FGFR1
shRNA construye sobre la expresión de la proteína FGFR1 en células NCI-H1581 como se ensayó por inmunotransferencia. shRNAs#1,#2 y#5 eficiente derribar FGFR1 expresión endógena en células NCI-H1581 infectadas con lentivirus shRNA-expresando mientras shRNAs#3 y#4 no. La actina se muestra como control de carga (panel inferior).
(B Opiniones y
C)
, la infección con tres horquillas independientes FGFR1-supresión (# 1,#2 y#5) inhibe la supervivencia de las células NCI-H1581 que sobreexpresa
FGFR1
(B) pero no inhibió la supervivencia de las células no albergar
FGFR1
amplificación, NCI-H2170 (C) como se evaluó por el ensayo de WST. NI, no hay infección. shGFP, específicos de control de horquilla para la proteína fluorescente verde se utiliza como un control negativo. Todos los resultados se normalizaron a la supervivencia de las células infectadas con shGFP.

A fin de validar la especificidad de los cambios de viabilidad celular asociados con la inducida por shRNA FGFR1-agotamiento, se analizó la capacidad de expresión ectópica de
FGFR1
ADNc para rescatar a los efectos de FGFR1 derriban. De tipo salvaje
FGFR1
cDNA, carece de la región 3 'no traducida (UTR) del ARNm de FGFR1 endógeno blanco de FGFR1 shRNA#1, se sobre-expresa en células NCI-H1581 transfectadas con este constructo shRNA. reconstituidas niveles de proteína FGFR1 tipo salvaje como resultado de rescate significativa del fenotipo inhibición de la supervivencia (Figura 3a, c), pero no tuvo impacto en el
FGFR1
células NCI-H2170-independiente (Figura 3b). En conjunto, estos experimentos implicar a
FGFR1
como un objetivo fundamental de oncogénico 8p11-12 amplificación.

(A) Gráfico de barras para el ensayo de rescate. Letalidad debido a niveles de agotamiento en el nivel endógeno en FGFR1 NCI-H1581 es rescatado por la sobreexpresión de tipo salvaje (WT) de longitud completa
FGFR1
secuencia de codificación. (B) No tiene efecto sobre la supervivencia de las células NCI-H2170 se observó debido a la sobre expresión de la forma de tipo salvaje de FGFR1. NCI-H2170 no es dependiente de la actividad FGFR1. NI, no hay infección. shGFP, específicos de control de horquilla para la proteína fluorescente verde se utiliza como un control negativo. Todos los resultados están normalizados a la supervivencia de las células infectadas con shGFP. Los datos mostrados están como media de tres repeticiones. (C) Validación de FGFR1 rescate por inmunotransferencia. niveles de agotamiento de nivel FGFR1 endógena en células NCI-H1581 infectados con
FGFR1
shRNA-expresando lentivirus dirigidas a la FGFR1 3'UTR (carril 1) es rescatado por la sobreexpresión de la forma de tipo salvaje de FGFR1 cDNA que carecen de la 3'UTR (carril 2) con rescate modesto concomitante en la fosforilación de residuos de tirosina niveles del sustrato FGFR1 FRS2 (panel medio). Actina se muestra como control de carga (panel inferior).

Es interesante que una línea de células de NSCLC que lleva un centro de coordinación
FGFR1
amplificación, NCI-H2444 (Figura S3), no fue sensible a desmontables de FGFR1 (datos no mostrados). Esta línea celular también alberga un activador
KRAS
G12V mutación [57], [58], que se asocia con la resistencia de los cánceres colorrectales a la terapia con cetuximab EGFR dirigida [25]. NCI-H2444 no muestra la fosforilación FRS2 (figura S4). Esta observación sugiere que la co-ocurrencia de otros oncogenes que activan puede aliviar
FGFR1
dependencia y específicamente que la resistencia primaria a la inhibición FGFR1 puede regirse por
KRAS
estado de la mutación.

FGFR los inhibidores de quinasa inhibe el crecimiento de
FGFR1
células NSCLC amplificados

Para evaluar la posibilidad de que la orientación
FGFR1 Hoteles en 8p11 SCC amplificados podría representar una nueva estrategia terapéutica en los CE, se estudió la efectos de la PD173074 inhibidor de pan-FGFR en líneas celulares de cáncer. La
FGFR1
células NCI-H1581 -amplified eran sensibles al tratamiento con PD173074 como se ensayó por formación de colonias en agar blando, con IC
50 en el rango de 10 a 20 nM (Figura 4a y la Figura S5). En contraste, las células NCI-H2170 con el tipo salvaje
FGFR1
número de copias fueron insensibles a PD173074 (Figura 4a). También se realizó curvas de respuesta de dosis PD173074 sobre la supervivencia celular en cultivo líquido para comparar la sensibilidad de las células que albergan
FGFR1
amplificación y los que no y otra vez encontraron que las células NCI-H1581 se sacrificaron a los valores de CI50 de 14 nM, mientras que las sin amplificación requiere más de 100 veces mayores dosis de PD173074 para inhibir la proliferación (Figura 4b). De acuerdo con estos resultados, también se observó que un segundo inhibidor irreversible FGFR, Fiin-1, inhibe la proliferación de células NCI-H1581 con el centro de coordinación
FGFR1 amplificación
en comparación con el NCI-H2170 sin
FGFR1
amplificación, con valores de IC50 de 2,5 nM frente a mayor que 10 micromolar, respectivamente (Figura S6).

(A) el tratamiento con las concentraciones indicadas de FGFR pan PD173074 inhibidor inhibe la formación de colonias en agar blando por el NCI-H1581 líneas celulares de cáncer albergar
FGFR1
amplificación, en comparación con la línea NCI-H2170, que no alberga
FGFR1
amplificación. Las colonias se fotografiaron y se cuantificaron después de 4 semanas. (B) El tratamiento con las concentraciones indicadas de PD173074 inhibió la supervivencia de las células NCI-H1581, pero no de las células NCI-H2170, como se determina por el ensayo de WST realizada después del tratamiento de 4 días. IC50 se indican.

Discusión

Aquí hemos demostrado que
FGFR1
se amplifica con frecuencia en los carcinomas de pulmón y que esta amplificación se enriquece en los CE de pulmón. línea celular de al menos un CPNM con focalmente amplificados
FGFR1
requiere el gen como se demuestra por el agotamiento del shRNA, y también es sensible a la inhibición con inhibidores de la quinasa FGFR.

Los genes distintos de
FGFR1
se han propuesto para ser el objetivo funcional de la amplificación en el segmento del cromosoma 8p11-8p12, más notablemente
WHSC1L1
[44] y
BRF2
[21]. Sin embargo, creemos que la evidencia presentada aquí, así como en un informe reciente [22] argumenta a favor de
FGFR1
como el objetivo funcional de la amplificación en al menos una línea de células de NSCLC. Además, en nuestro conjunto de datos
WHSC1L1
no se amplifica en todos los
FGFR1
muestras amplificadas, argumentando que es poco probable que sea el único gen amplificado relevante en el 8p11-12 amplicón. La línea celular que mostraron la necesidad de
WHSC1L1
para su supervivencia, NCI-H1703 [44], no se sobre-expresa FGFR1 (Figura 1c), no muestra la fosforilación FRS2 (figura S4) y es dependiente otro oncogén amplificado tirosina quinasa,
PDGFRA
[19], [20]. Por el contrario, desmontables de
WHSC1L1
tenido ningún impacto en
FGFR1
,
FGFR1
que expresan las células NCI-H1581 -amplified, lo que sugiere que la amplificación del gen o bien puede contribuir a celular transformación en el contexto celular apropiado.

un estudio reciente caracterización de la amplificación de ADN en el CPNM sugirió que
BRF2
, que codifica una subunidad complejo de iniciación de la transcripción de ARN polimerasa III, es el objetivo de la amplificación en el 8p11 amplicón [21]. Se comparó
FGFR1 amplificación para

BRF2
amplificación de la luz de este informe y se encontró que de 12 muestras de la más alta amplificación de
FGFR1
en nuestro conjunto de datos (log2 ratio & gt;

El conocimiento de la salud

Mesotelioma Diagnóstico y qué a Expect

Diagnosis es un problema importante en el mesotelioma. Como

Los síntomas de la ciática espinal

Inicialmente, el paciente debe ser diagnosticado que se basa

Durban cáncer Hospitals

Esta sección le ayuda a buscar los detalles completos de los

Los principales hitos en la Investigación del Cáncer

No hay duda de que cuando se menciona el cáncer de la gente

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]