Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: Mecanismos de derivación del Camino del receptor de andrógenos en la célula del cáncer de próstata resistente a la terapia Models
PLOS ONE: Mecanismos de derivación del Camino del receptor de andrógenos en la célula del cáncer de próstata resistente a la terapia Models

2016/9/7


Extracto

Antecedentes

El cáncer de próstata depende de los andrógenos inicialmente para la supervivencia y el crecimiento, haciendo la terapia hormonal la piedra angular del tratamiento para los tumores en etapa tardía. Sin embargo, a pesar de la remisión inicial, el cáncer, inevitablemente se repita. El presente estudio fue diseñado para investigar cómo las células del cáncer de próstata andrógeno-dependientes, finalmente, sobrevivir y reanudar el crecimiento en condiciones de andrógenos-privada y antiandrógeno suplementados. Como sistema modelo, se utilizó la línea celular PC346C sensible a los andrógenos y sus resistentes a la terapia sublíneas:. PC346DCC, PC346Flu1 y PC346Flu2

Metodología /Principales conclusiones

La tecnología de microarrays se utilizó para analizar las diferencias en expresión de genes entre las líneas celulares PC346 andrógeno-sensibles y resistentes a la terapia. el análisis de microarrays reveló 487 transcripciones diferencialmente expresados ​​entre el las líneas celulares resistentes a la terapia de andrógeno-sensibles y. La mayoría de estos genes eran comunes a los tres sublíneas resistentes a la terapia y sólo una minoría (~ 5%) fue regulada por andrógenos. Pathway análisis reveló enriquecimiento en funciones que implican movimiento celular, el crecimiento celular y la muerte celular, así como la asociación con el cáncer y la enfermedad del sistema reproductivo. PC346DCC expresó niveles residuales de receptor de andrógenos (AR) y mostró significativa baja regulación de los genes regulados por andrógenos (p-valor = 10
-7). Sobre regulación de oncogenes y la represión de la DKK3 supresor de tumores y Vav3 TWIST1 se observó en PC346DCC, lo que sugiere un posible mecanismo de bypass AR. validación posterior de estos tres genes en muestras de pacientes confirmó que la expresión fue desregulado durante la progresión del cáncer de próstata.

Conclusiones /Importancia

crecimiento resistentes a la terapia pueden resultar de las adaptaciones en la vía de AR, pero andrógenos independencia también se puede conseguir mediante mecanismos de supervivencia alternativos. Aquí hemos identificado TWIST1, Vav3 y DKK3 como jugadores potenciales en la derivación de la vía AR, haciéndolos buenos candidatos como biomarcadores y nuevas dianas terapéuticas

Visto:. Marques RB, Dits NF, Erkens-S Schulze, furgoneta Weerden WM, Jenster G (2010) Mecanismos de derivación del receptor de andrógenos Camino en modelos celulares de cáncer de próstata resistente a la terapia. PLoS ONE 5 (10): e13500. doi: 10.1371 /journal.pone.0013500

Editor: Chad Creighton, Baylor College of Medicine, Estados Unidos de América

Recibido: 1 de julio de 2010; Aceptado: September 29, 2010; Publicado: 19 Octubre 2010

Derechos de Autor © 2010 Marques et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Financiación:. El trabajo presentado en este manuscrito fue apoyada financieramente por la Organización holandesa para la Investigación Científica (NWO), a través de ZonMW concesión 903-46-187, y por el holandés Cancer Society (KWF), a través de subvenciones y NKB97-1479 DDHK 2001-2455. Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:.. Los autores han declarado que no existen intereses en competencia

Introducción

el cáncer de próstata (CaP) es la segunda causa principal de muertes por cáncer en varones en los países occidentales y un problema creciente en los que adoptan el estilo de vida occidental y la dieta. Los avances en la detección y el diagnóstico han permitido la detección de tumores en etapas más tempranas, cuando el tratamiento curativo sigue siendo viable. Para la enfermedad diseminada etapa tardía sin embargo, las terapias actuales son meramente paliativos y no existe un tratamiento curativo. Puesto que el crecimiento de los tumores de próstata es dependiente de andrógenos originalmente, cánceres metastásicos generalmente son tratadas con terapia de ablación de andrógenos, con o sin suplementación antiandrógeno [1], [2]. La gran mayoría de estos pacientes muestran una regresión clínica significativa, pero el cáncer con el tiempo se repite dentro de 12-18 meses. Estos tumores recurrentes se han escapado de supresión androgénica y se hizo resistente a la terapia hormonal, que se refiere como la hormona-refractario o resistente a la castración CaP. Para sobrevivir y reanudar el crecimiento en un entorno de andrógenos privados de células de CaP deben o bien adaptar la vía del receptor de andrógenos (AR) a las condiciones de andrógenos agotado o invocar de supervivencia y crecimiento vías alternativas [3]. evidencia experimental Mucho existe para apoyar ambos mecanismos, que no son necesariamente mutuamente excluyentes. AR expresión se demostró que se mantiene en la mayoría de los pacientes que se sometieron a la terapia hormonal y que mostraron recurrencia de la enfermedad, lo que sugiere un papel de la AR también en la enfermedad en etapa tardía [4], [5]. Por otra parte, el gen AR se amplifica y /o sobreexpresa en aproximadamente el 30% de los tumores refractarios de terapia hormonal, y se ha propuesto que esto podría sensibilizar el receptor para las concentraciones de andrógenos residuales y antiandrógenos presente bajo las terapias hormonales [6], [7 ], [8]. Además, varias mutaciones AR, lo que resulta en aumento de la actividad o ampliado ligando especificidad a los esteroides alternativos y antiandrógenos, se han asociado con progresión de la enfermedad [9], [10]. Otras modificaciones de la vía de AR que pueden inducir el crecimiento refractario a las hormonas incluyen la esteroidogénesis intratumoral, la activación independiente de ligando por diafonía con otras vías de señalización, las alteraciones en el equilibrio de AR co-reguladores o expresión de las isoformas AR truncadas constitutivamente activa [3] , [11], [12]. Curiosamente, el trabajo reciente de los demás y nos ha revelado que la vía de AR se puede atenuar selectivamente en la enfermedad avanzada /metastásica [13], [14], [15]. Desde la vía de AR también está involucrado en los procesos de diferenciación celular y la maduración de la próstata, es tentador sugerir que las células de CaP pueden obtener finalmente ventaja de crecimiento mediante la inhibición de la diferenciación inducida por AR. Impulsada por estos resultados, nos centramos en el presente estudio de supervivencia y crecimiento de vías alternativas, que son independientes de la activación de AR. Para evitar de manera efectiva la vía AR, las células epiteliales de cáncer deben ser capaces de sobrevivir a las señales de apoptosis desencadenada por las terapias hormonales e invocar las vías alternativas de crecimiento. la producción autocrina de factores de crecimiento o sus receptores, la activación de oncogenes y la inhibición de genes supresores de tumores son todos los mecanismos posibles para pasar por la vía de AR. Consistente con esta hipótesis, los factores de crecimiento paracrinos que normalmente son secretadas por las células del estroma de la próstata, tales como el factor de crecimiento epidérmico (EGF), factor de crecimiento similar a la insulina 1 (IGF1), factor de crecimiento de hepatocitos (HGF), factor de crecimiento de queratinocitos (KGF) o interleucina 6 (IL-6), se encontró que la sobreexpresión en el cáncer refractario a las hormonas en asociación con un interruptor para la producción autocrina por las células epiteliales de cáncer [16]. Además de ser mitógenos potenciales, la creciente evidencia indica que estas hormonas de crecimiento también son capaces de diafonía con la vía de señalización AR, lo que lleva a la expresión de AR genes diana en ausencia de andrógenos [17]. Por lo tanto, todavía tiene que determinar si la producción autocrina de estos factores de crecimiento representa una adaptación o una verdadera derivación de la vía de señalización AR. Las alteraciones en el anti-apoptótica
BCL2
oncogén y en el pro-apoptótica
P53
y
PTEN
genes supresores de tumores también se han encontrado en el cáncer de próstata [18], [19]. Sin embargo, estos eventos ocurren sobre todo antes de la progresión etapa tardía, haciendo que sean menos probables candidatos para el cambio a la hormona de crecimiento refractario en la enfermedad en etapa tardía. Sin embargo, mediante la inhibición de la muerte celular CaP y cambiar el equilibrio hacia la proliferación celular, los genes implicados en la regulación de la apoptosis pueden también jugar un papel en el crecimiento de la hormona-refractario.

Para explorar el mecanismo (s) por el cual los andrógenos células de CaP dependientes se vuelven resistentes a la terapia hormonal, que utilizan la tecnología de microarrays para interrogar a las diferencias en la expresión génica entre las líneas celulares andrógeno-sensibles y resistentes a la terapia. Como sistema modelo se utilizó la línea celular PC346C sensible a los andrógenos y sus sublíneas resistentes a la terapia PC346DCC, PC346Flu1 y PC346Flu2. Estas sublíneas se derivaron de la PC346C parental por ablación a largo plazo de andrógenos (PC346DCC), suplementado con la hidroxiflutamida antiandrógeno (PC346Flu1 y PC346Flu2) [20], [21]. Estudios previos revelaron modificaciones AR distintas en los tres sublíneas resistentes a la terapia, lo que correspondió a la diversa mecanismo de crecimiento refractario a las hormonas. Mientras que PC346DCC, que expresan niveles muy bajos de AR y PSA, mostró evidencia de derivación de la vía AR, PC346Flu1 exhibió 4 veces AR se mostró sobre regulación y PC346Flu2 para llevar la mutación T877A AR. Los dos sublíneas PC346Flu1 y PC346Flu2 replican la progresión de la enfermedad refractaria a la terapia hormonal a través de adaptaciones de la vía de AR. Por lo tanto, nos centramos en la sublínea PC346DCC para seleccionar los genes que intervienen en especial en el bypass de la vía de AR. Además de proporcionar nuevos conocimientos sobre los mecanismos de progresión del CaP, los genes identificados aquí pueden resultar útiles como marcadores pronósticos y objetivos potenciales para nuevos enfoques terapéuticos.

Métodos

Reactivos y líneas celulares

la línea celular PC346C se derivó del tumor de próstata de un paciente con adenocarcinoma de próstata no progresiva (T4N0M0) [20], [21]. El PC346DCC, PC346Flu1 y PC346Flu2 sublíneas se derivaron de PC346C al cultivo a largo plazo en un medio con carbón vegetal, con o sin suplementación antiandrógeno hidroxiflutamida, respectivamente. El desarrollo y la caracterización de estas líneas celulares se han publicado anteriormente [20], [21]. El medio de cultivo básico que se utiliza en el mantenimiento de líneas celulares PC346 consistía en medio DMEM-F12 (Cambrex BioWhitaker, Bélgica) suplementado con 2% de suero de ternera fetal (FCS; PAN Biotech GmbH, Aidenbach, Alemania), 1% de insulina-transferrina-selenio (Gibco BRL), 0,01% de albúmina de suero bovino (Boehringer Mannheim, Alemania), 10 factor de ng /ml de crecimiento epidérmico (Sigma-Aldrich), penicilina /antibióticos estreptomicina (100 U /ml de penicilina, 100 mg /ml de estreptomicina; BioWhitaker, Bélgica ); con las siguientes adiciones: 100 ng /ml de fibronectina (Harbor Bio-Products, tebu-bio, Países Bajos), 20 mg /ml fetuine (ICN Biomedicals, Países Bajos), 50 ng /ml choleratoxin, fosfoetanolamina 0,1 mM, 0,6 ng /ml triyodotironina y 500 ng /ml dexametasona (todos de Sigma). células PC346C se mantuvieron en cultivo en el medio completo descrito anteriormente, suplementado con 0,1 nM 17-metiltrienolona (R1881; NEN, Boston MA, EE.UU.). medio de selección PC346DCC fue suplementado como se describe anteriormente, pero agota de andrógenos mediante el uso de carbón vegetal revestido con dextrano (DCC) tratados FCS. PC346Flu1 y medio de cultivo PC346Flu2 también se agotan andrógenos mediante el uso de un 2% DCC-FCS, y se complementarán con 1 M de hidroxiflutamida (OH-flutamida, Instituto de Investigación de Schering-Plough, Nueva Jersey, EE.UU.).

Las células se cultivaron en Primaria T25 ™ frascos de cultivo de tejidos (BD Biosciences Benelux NV, Países Bajos) a 37 ° C en 5% de CO
2 atmósfera húmeda.

Expresión análisis de microarrays

Las células fueron sembradas en su respectivo medio de selección para llegar a ~ 50% de confluencia y se dejó crecer durante 2 días. Luego, se enjuagaron las células dos veces con PBS y se almacenaron a -20 ° C hasta que el aislamiento de ARN. Se aisló ARN total con el reactivo RNAzol B (Campro Scientific, Veenendaal, Países Bajos) y se purificó adicionalmente a través de columnas RNeasy (Qiagen) con la digestión de ADN en columna, de acuerdo con el protocolo del fabricante. la calidad del ARN se comprobó en gel de agarosa al 1%.

Cy3 o sondas de ARN marcadas con Cy5 se produjeron mediante la incorporación de UTP amino-alilo durante la amplificación de ARN, seguido de acoplamiento de colorante modificado N-hidroxisuccinimida. Brevemente, se utilizó 3 RNA g para un protocolo de amplificación de ARNm lineal a base de T7, se ha descrito previamente [22]. UTP Amino-alilo, además de la misma cantidad de rUTP sin modificar, se incorporó en ARNa con T7 Megascript Kit (todos de Ambion), de acuerdo con el protocolo del fabricante. ARN amplificado se purificó y se concentró utilizando Microcon YM-30 columnas (Amicon) para enjuagar tres veces con 300 l de agua libre de ARNasa. Por último, 2 g aminoallyl modificado con RNA, en un máximo de 3,33 l de RNasa libre de agua, se incubó con 1,66 l de tampón de bicarbonato de sodio (0,3 M, pH 9) y 5 l Cy3 o Cy5 tinte (CyScribe Post-Etiquetado kit, Amersham, NJ, EE.UU.), durante 1 h en la oscuridad a temperatura ambiente. La reacción se detuvo con 5 l de hidroxilamina 4 M de HCl (Sigma), sondas de la contra etiqueta se combinaron y se purificaron /concentró utilizando Microcon YM-30 de la sonda se recogió en un volumen final de 5-15 l y se resuspendió en 80 l de tampón de hibridación número 1 Ambion .

en el microarray se utilizó oligoarrays doble tinte que representan alrededor de 15.000 genes humanos, en el que la etiqueta de ARN de la cada sublínea resistente a la terapia fue cohybridized con PC346C contraindicado marcado. Cuatro microarrays se realizaron por condición, con dos pases de células diferenciadas en el tinte del canje. Esto fue hecho para tener en cuenta la variabilidad biológica y excluir de tinte unión preferencial a los oligonucleótidos en la micromatriz. Los oligoarrays utilizados en este estudio fueron producidas en el Centro Erasmus para Biomics. En pocas palabras, un ser humano 18,584 oligonucleótidos biblioteca (Compugen, Sigma-Genosys) fue visto en las diapositivas utilizando un aminosilano arrayer Virtek ChipWriter Profesional (Virtek Vision International, Waterloo, Canadá). puntos de control incluyeron puntos de referencia, tampón manchas, oligonucleótidos alienígenas (SpotReport oligo gama de Alien, La Jolla, Stratagene), poli d [A] 40-60, ADN de esperma de salmón, y humano ADN Cot-1. Antes de la hibridación, microarrays diapositivas se prehibridaron en 5x SSC, SDS, 4% de solución de BSA al 0,05% durante 30 min a 45 ° C, se lavaron dos veces con agua libre de ARNasa durante 2 minutos, se enjuaga con isopropanol y Spin seca durante 3 minutos a 1500 g. Microarray hibridaciones se llevaron a cabo durante la noche a 45 ° C, con agitación continua, en una estación de hibridación HS4800 (Tecan Benelux BV). Finalmente, los arrays se lavaron automáticamente en la estación de hibridación usando:. 2x SSC /0,05% de SDS (a 45 ° C), 1x SSC y 0,2 x SSC (a temperatura ambiente) y se secó bajo una corriente de N2, antes de escanear

extracción de los datos y el análisis

Las matrices fueron escaneadas en un escáner HT ScanArray Express (Perkin Elmer, Nederland BV) y las intensidades de terreno se cuantificaron utilizando el software Imagene (Bio Inc Descubrimiento, el Sequndo, CA, EE.UU. ). Para equilibrar Cy3 y Cy5 intensidades de terreno, Loewess normalización por subarreglo se realizó utilizando limma-paquete (http://bioinf.wehi.edu.au/limma/) de Bioconductor (http://www.bioconductor.org) [23] , [24]. Para escalar entre las matrices, la intensidad media mundial por matriz se fijó en 1000. Dye intensidades inferiores a 200 luego fueron umbrales concretos a 200, para minimizar el ruido y hacer veces de cambio en el rango de baja intensidad más robusto frente a los valores atípicos. Spots con intensidades por debajo del umbral (200) para ambos canales Cy3 y Cy5 en más de 2 de los 4 arrays realizadas por sublínea se excluyeron del análisis. Muestra para hacer referencia a ratios se calcula entonces y 2log transformado. Las manchas que mostraban efectos opuestos para el tinte de canje /repeticiones biológica se excluyeron del análisis adicional; efectos fueron llamados contrario si la relación 2log media de la sublínea por fuera ≥0.5 de un colorante y por debajo de ≤-0,5 para el tinte del canje. Tras la normalización y todos los controles de calidad anteriormente mencionados, las relaciones de intensidad 2log se promediaron para las réplicas de cada sublínea. Estos datos se almacenan en SRS7 (Sistema de Recuperación de secuencias versión 7, Lion Bioscience AG, Heidenberg, Alemania), que también se usó para las comparaciones con otras bases de datos previamente publicados /acceso público [25]. Los datos de microarrays se depositó en el Gene Expression Omnibus repositorio (http://www.ncbi.nlm.nih.gov/geo/bajo el número GEO adhesión GSE21596). La agrupación jerárquica y visualización de datos se ha realizado mediante programas de racimo y TreeView (Eisen Labs: http://rama.lbl.gov). se utilizó para determinar qué genes fueron estadísticamente diferentes entre las muestras estimuladas y no estimuladas referencias; Análisis de la importancia microarrays (SAM http://www-stat.stanford.edu/~tibs/SAM). la agrupación de genes ontología se realizó a través de bases de datos para anotación, y Visualización Integrada Discovery (DAVID: http://david.abcc.ncifcrf.gov) [26], [27]. Los análisis funcionales de la vía y se generaron mediante el uso de Ingenuity Pathways Analysis (Ingenuity® Systems, www.ingenuity.com).

síntesis de cDNA y análisis de RT-PCR

normales y tumorales de muestras pacientes utilizados para análisis en tiempo real RT-PCR cuantitativa se obtuvieron del banco de tejidos congelados del Centro Médico Erasmus (Rotterdam, Holanda). Los especímenes fueron recolectados entre 1984 y 2001. Los protocolos experimentales fueron aprobados por el Comité de Ética Médico Erasmus MC de acuerdo con la investigaciones médicas en seres humanos actúan. Información adicional sobre estos especímenes se proporcionó anteriormente. [28] El ARN total se aisló como se ha descrito anteriormente y se sintetizó ADNc utilizando
12-18 MMLV-kit de transcriptasa inversa y oligo (dT) (Invitrogen), de acuerdo con el protocolo del fabricante. cDNA muestras fueron almacenadas a -20 ° C. Análisis en tiempo real PCR TaqMan se llevó a cabo en un sistema ABI Prism 7700 de detección de secuencias (Applied Biosystems, Foster City, CA), usando ADN polimerasa AmpliTaq Gold (Applied Biosystems), de acuerdo con las especificaciones del fabricante. cebadores validados y sondas de TaqMan Gene ensayos de expresión (Applied Biosystems) se utilizaron para la cuantificación de Vav3 (Hs00916821_m1), TWIST1 (Hs00361186_m1), DKK3 (Hs00951307_m1) y GAPDH (Hs99999905_m1), de acuerdo con la configuración de PCR proporcionados por Applied Biosystems. PBGD se cuantificó utilizando 0,33 M de cebadores directos: CATGTCTGGTAACGGCAATG y retroceso: cebadores GTACGAGGCTTTCAATGTTG, en energía SybrGreen PCR Master Mix (Applied Biosystems), según el protocolo de termociclado recomendado por el fabricante. cantidades de transcripción de cada muestra se normalizaron frente a la media de dos referencias endógenos y con relación a un calibrador. Los dos genes de limpieza utilizados como referencias endógenos fueron
PBGD
y
GAPDH
; se utilizó una mezcla de ADNc de xenoinjertos de carcinoma de próstata como calibrador. Los gráficos y las estadísticas se realizaron con GraphPad Prism (versión 3.0). & lt; P-valores de 0,05 se consideraron significativos

Resultados

perfil de expresión génica diferencial entre el PC346C sensible a los andrógenos y sus sublíneas resistentes a la terapia
se realizó
serie de análisis de expresión. explorar si la vía AR todavía está activo en las células refractarias de terapia hormonal en condiciones de andrógenos-privados e identificar las vías de crecimiento /supervivencia alternativas putativos. Cada una de las sublíneas resistentes a la terapia se cultivaron en su respectivo medio de selección (medio de esteroide-despojado para PC346DCC, suplementado con 1 mM OH-flutamida para PC346Flu1 y Flu2) y se hibridó en los microarrays, junto con el PC346C andrógenos sensible parental (de cultivo en medio completo suplementado con 0,1 nM R1881). Para tener en cuenta la variabilidad biológica y de tinte unión preferencial a los oligonucleótidos en la micromatriz, cuatro arrays se realizaron por condición, usando dos pases de células independientes en tinte de canje. La variación en el patrón de expresión se analizó por sublínea resistente a la terapia, y se consideraron los puntos que se expresó diferencialmente si la relación 2log absoluta ≥ 0,5 (relación ≥ 1,42 o ≤0.71) durante al menos tres de los 4 arrays y para la media de todos los 4 matrices. De acuerdo con estos criterios, hubo un total de 487 transcripciones regulados diferencialmente en las sublíneas resistentes a la terapia en comparación con PC346C andrógeno-sensibles, la mayoría de los cuales se superponen los tres sublíneas refractarios (Fig. 1). Con 276 transcripciones regulados diferencialmente, PC346DCC mostró la divergencia más fuerte de la línea parental, mientras que los menos PC346Flu2 reveló alteraciones (127 transcripciones). Se utilizó el análisis de la importancia microarrays (SAM) para determinar la significación estadística de los genes seleccionados y, a una tasa de falso descubrimiento 5%, 392 de la 487 (80%) seleccionado alcanzó significación estadística. Los mejores 100 genes expresados ​​diferencialmente entre la las líneas de células sensibles a andrógenos y resistente a la terapia, los respectivos coeficientes de expresión y el análisis estadístico se presentan en las tablas 1 y 2. Una lista completa de todos los genes regulados por sublínea se presenta en los cuadros S1 a S3 . Curiosamente, una proporción considerable (64/487) de los genes regulados diferencialmente agrupados en distintos lugares del genoma en los cromosomas 4, 5, 6, 8, 11 y 18 (valor de p & lt; 0,05; Tabla 3).

PC346C se cultivó en medio completo con 0,1 nM R1881, mientras que las sublíneas refractarios a las hormonas fueron cultura en carbón vegetal revestido con dextrano medio despojado (PC346DCC), suplementado con 1 mM de la hidroxiflutamida antiandrógeno (PC346Flu1 y PC346Flu2). A) Representación mapa de calor: los colores rojo y verde representan la sobre regulación y baja regulación, respectivamente, mientras que el negro indica que no hay diferencia entre sublíneas y células PC234C parentales. cuadrados grises indican los datos que faltan, ya sea debido a los bajos niveles de expresión, la mala calidad de los datos o ausencia de sondas para la transcripción correspondiente en la plataforma de matriz utilizada para el estudio. B) Venn-diagrama del número de genes regulados en las diferentes sublíneas.


vía AR es el regulado en PC346DCC

Para investigar el estado de activación de la vía de AR en el PC346DCC, PC346Flu1 y PC346Flu2, la base de datos SRS se utiliza para vincular y comparar nuestros datos actuales con un previamente establecido firma gen andrógeno-respuesta (Fig. 2A). Esta firma de andrógenos-respuesta se determinó por análisis de microarrays de expresión, después de la estimulación de las diferentes líneas celulares PC346 con el andrógeno sintético R1881 o la hidroxiflutamida antiandrógeno (Tabla S4). De los 487 transcripciones reguladas diferencialmente en las sublíneas resistentes a la terapia, sólo el 27 eran genes diana AR (& lt; 6%), que indica que otros genes y las vías también están involucrados en la terapia hormonal proliferación refractario de estas sublíneas. Por otra parte, los genes diana de AR se redujeron regulado en PC346DCC (p-valor = 10
-7), mientras que su expresión en PC346Flu1 y PC346Flu2 no se vio afectada significativamente (Fig. 2B). Sin embargo, aunque no estadísticamente significativa para la vía de AR en su conjunto, y PC346Flu1 PC346Flu2 sí mostraron inducción inferior de algunos genes sensibles a andrógenos, tales como KLK2, STEAP1, STEAP2 y EHF.

genes expresados ​​diferencialmente en la hormona PC346 sublíneas -refractory frente PC346C padres estaban vinculados a una firma genética andrógeno-respuesta previamente establecida (ver sección de Materiales y Métodos). (A) mapa de calor representación de los genes sensibles a andrógenos desregulados en cualquiera de las sublíneas refractarios a las hormonas PC346. Combinación de colores como se describe en la Fig. 1. (B) de Venn-diagrama y las correspondientes estadísticas.

ontología de genes y la vía de análisis identifica el cáncer de la firma

La firma 487-gen seleccionado se clasificó de acuerdo a la ontología de genes (GO) los procesos biológicos usando la base de datos para anotación, y Visualización integrada Discovery (DAVID) [26], [27]. análisis de anotación agrupación mostró enriquecimiento en categorías que participan en el desarrollo de órganos, la diferenciación sistema reproductivo, el crecimiento celular, la diferenciación y la apoptosis (Tabla 4). Ingenuity Pathway Analysis se utilizó para identificar el enriquecimiento en "enfermedades y trastornos", "funciones moleculares y celulares", y la búsqueda de vías intrínsecas /redes dentro de los conjuntos de genes seleccionados (www.ingenuity.com). cáncer y enfermedades del sistema reproductivo se clasificaron en el top 3 de las "enfermedades y trastornos", que lógicamente confirmaron el enriquecimiento de los genes asociados con CaP, como hepsin, clusterina, receptor de la vitamina D, factor trébol 3, proteína D52 del tumor, la AR en sí y varias de sus genes diana (Fig. 3A y 3B, respectivamente). Además, se utilizó el análisis de red para detectar la firma 276-gen de PC346DCC de las posibles vías alternativas de crecimiento que podrían estar involucrados en pasar por la AR señalización. Curiosamente, la señalización a través del receptor de la hormona del crecimiento (GHR), receptor de la insulina (INSR) y el receptor del factor de crecimiento epidérmico fue entre las 10 redes (puntuación = 20) que muestra la desregulación en PC346DCC (Fig. 3C).

Top 5 funciones biológicas enriquecidas en las sublíneas resistentes a la terapia: (a) enfermedades y trastornos, (B) funciones moleculares y celulares. (C) Ejemplo de análisis de red para PC346DCC que muestra la desregulación de la señalización de la hormona del crecimiento y del receptor del factor-: genes regulados están representados en los genes reprimidos en rojo y verde. El análisis se realizó utilizando el software Ingenuity Pathway Analysis (www.ingenuity.com).

Análisis Integral revela genes desregulados en la progresión del cáncer de próstata

Para identificar los genes modulados en el CaP que podría explicar el crecimiento refractario a la terapia hormonal a través de derivación de la vía de AR, que vinculó la firma de 276 genes de PC346DCC con datos de siete estudios de microarrays CaP publicados anteriormente (Tabla 5) [14], [29], [30], [31 ], [32], [33], [34]. Sólo los genes presentes en al menos 5/7 de bases de datos (209 genes) y desregulados en por lo menos 3/7 (111 genes) se incluyeron para el análisis adicional. La agrupación jerárquica se realiza en los genes de la firma (primera columna), junto al cáncer primario versus normal de la próstata (segunda columna), el cáncer metastásico vs cáncer primario (tercera columna) y, finalmente, refractario a las hormonas contra la enfermedad hormona-naïve (cuarta columna ), se muestra en la Fig. Se encontraron 4. Aproximadamente el 30% de los genes expresados ​​diferencialmente en PC346DCC ser desregulado consistente en el CaP metastásico en comparación con la enfermedad limitada al órgano.

La firma 276-gen de PC346DCC estaba vinculado a los datos de microarrays cáncer de próstata 7 bases de datos de primaria (Lapointe, Varambally, Tomlins, Yu), metastásico (Chandran, Lapointe, Varambally, Tomlins, Yu) y la hormona de terapia de tumores refractarios (Tamura, Tomlins y mejor). Sólo los genes presentes en al menos 5/7 de bases de datos (209 genes) y desregulados en por lo menos 3/7 (111 genes) se incluyeron en el análisis. Heat-mapa representación de (A) 72 sobreexpresado y (B) 39 genes reprimidos en PC346DCC. (C) los genes desregulados seleccionados para su posterior análisis qPCR. Combinación de colores como se describe en la Fig. 1. cuadrados grises indican los datos que faltan, ya sea debido a los bajos niveles de expresión, la mala calidad de los datos o ausencia de sondas para la transcripción correspondiente en la plataforma de matriz utilizada para el estudio. PC-NAP: cáncer de próstata menos de próstata normal adyacente; MET-PC: tumores de próstata metástasis menos primaria; HR-HN:. Tumores hormono-refractario ingenuo menos de terapia hormonal

TWIST1, DKK3 y Vav3 como marcadores para el diagnóstico de la enfermedad y el pronóstico

Sobre la base de sus funciones patológicas reconocidas y la desregulación consistentes en múltiples bases de datos de CaP, homólogo de giro 1 (TWIST1), fueron seleccionados vav factor de intercambio de nucleótidos guanina 3 (Vav3) y Dickkopf homólogo 3 (DKK3) por su posible papel en el bypass de la vía de AR. De esta manera, TWIST1 y Vav3 son oncogenes putativo implicadas en la señalización de hormona de crecimiento, como se revela por análisis Ingenuity Pathway (Fig. 3C). Por otro lado, DKK3 es un supresor de tumores, mostrando una fuerte baja regulación de los conjuntos de datos de Chandran
et al.
, Lapointe
et al.
Y Varambally
et al.
(Fig. 4C). Mientras que TWIST1 mostró regulación consistente en conjuntos de datos primarios y metastásicos de PCA de Varambally
et al.
, Yu
et al.
, Lapointe
et al.
Y Chandran
et al.
, Vav3 se había reducido regulado en los tumores primarios seguidos de regulación en la metástasis (Fig. 4C).

RT-PCR cuantitativa se realizó en un conjunto independiente de muestras de próstata, obtuvo la prostatectomía radical o la resección transuretral de la próstata de los pacientes siendo operado en la clínica Erasmus MC. Este panel contiene 21 muestras de tejido de la próstata benigna y 74 adenocarcinomas en los diferentes estadios de la enfermedad. Análisis cuantitativo de PCR mostró sobre regulación de TWIST1 en muestras de CaP primarios y metástasis en los ganglios linfáticos (valor P = 0,0001 y 0,002, respectivamente). No se observaron diferencias entre los tumores hormono-refractario (CPRH) y de la hormona-naïve (hNPC) (Fig. 5A). DKK3 expresión fue significativamente disminuido en el CP y la metástasis de los ganglios linfáticos (P-valor ≤0.0001), aunque no se observaron diferencias en la progresión de órgano-confinado a una enfermedad metastásica o refractario a las hormonas (Fig. 5B). Vav3 expresión disminuyó gradualmente durante la progresión del CaP, con los niveles más bajos observados en los tumores metastásicos de próstata (P-valor = 0,0001 para después de la prueba lineal de la tendencia) y muestras refractarios a las hormonas (valor de p = 0,005 para hNPC vs. CaPHR; Fig. 5C ). muestras de ganglios linfáticos se retiraron del análisis Vav3 en la Fig. 5C, porque Vav3 fue altamente expresado en los ganglios linfáticos normales en comparación con tejidos de la próstata normales (datos no mostrados). En esta configuración, la presencia de restos de tejido del ganglio linfático normal puede dar lugar a una sobreestimación de la cantidad Vav3 real en la metástasis de los ganglios linfáticos. De Kaplan-Meier análisis mostró una correlación directa entre la expresión Vav3 y la supervivencia libre de metástasis (p-valor = 0,004 para la prueba de tendencia Logrank; Fig. 5D).

muestras de tumores de próstata se obtuvieron mediante prostatectomía radical o resección transuretral de la próstata de los pacientes siendo operado en la clínica Erasmus MC. Este panel contiene 21 muestras de tejido de próstata benignas y 74 adenocarcinomas en los diferentes estadios de la enfermedad. (A) TWIST1; (B) DKK3; (C) Vav3 expresión en muestras de próstata; (D) Vav3 análisis de la supervivencia libre de metástasis. NAP: próstata normal adyacente; PC: cáncer de próstata primario; LNmet: metástasis a los ganglios linfáticos; PC-Met: Órgano-confine el cáncer de próstata no progresiva; PC + Met: tumor primario de cáncer de próstata progresivo que, o bien tenía o desarrolló metástasis durante el seguimiento posterior; HN: hormonas ingenuo; HR: la terapia hormonal-refractario; (*) P-valor ≤0.0001 y (**) Valor de p ≤0.005 mediante la prueba de Mann-Whitney de dos colas. (***) Valor de p ≤0.0001 con el poste de la prueba lineal-tendencia.

Discusión

En el presente estudio se utilizó el análisis de microarrays para identificar diferencias en el patrón de expresión génica de la línea celular PC346C sensible a los andrógenos y sus resistentes a la terapia sublíneas: PC346DCC, PC346Flu1 y PC346Flu2. Este análisis ha detectado 487 transcripciones regulados diferencialmente en las células refractarias-terapia hormonal frente a la PC346C los padres. Muchos de éstos eran comunes a todas las sublíneas resistentes a la terapia, a pesar de las diferentes modificaciones de la vía AR, lo que sugiere adaptaciones mejora del crecimiento similares (Fig. 1).

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]