Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: Mycoplasma hyorhinis Activa la NLRP3 inflamasoma y promueve la migración y la invasión de células de cáncer gástrico
PLOS ONE: Mycoplasma hyorhinis Activa la NLRP3 inflamasoma y promueve la migración y la invasión de células de cáncer gástrico

2013/3/31


Extracto

Antecedentes


Mycoplasma hyorhinis gratis (
M.hyorhinis, M.hy
) se asocia con el desarrollo de cáncer gástrico y de próstata. Inflamasoma NLRP3, un complejo de proteínas que controla la maduración de las citoquinas pro-inflamatorias importantes interleuquina (IL) -1β e IL-18, también está involucrado en la tumorigénesis y metástasis de varios tipos de cáncer.

Metodología /Principales conclusiones

para aclarar si
M.hy
ha promovido el desarrollo de tumores a través de la activación inflamasoma, se analizaron los monocitos de IL-1β e IL-18 de producción en
M.hy
desafío. Cuando se expone a
M.hy
, monocitos humanos exhiben rápida y robusta IL-1β y IL-18 secreción. Se identificaron además que la proteína de membrana asociada a lípidos (LAMP) de
M.hy
era responsable de la inducción de IL-1β. La aplicación de inhibidores competitivos, shRNA gen específico y ratones de genes dirigidos, se verificó que
M.hy
ha inducido la secreción de IL-1β fue NLRP3 dependiente de
in vitro en
y
in vivo
. actividad de la catepsina B, K
+ flujo de salida, Ca
2 + afluencia y la producción de ROS eran todos necesarios para la activación inflamasoma NLRP3 por
M.hy
. Es importante destacar que, es IL-1β, pero no IL-18 producido a partir de macrófagos estimulados con
M.hy
promovió la migración de células de cáncer gástrico y la invasión.

Conclusiones

Nuestros datos sugieren que la activación de la inflamasoma NLRP3 por
M.hy
puede estar asociada con la promoción de la metástasis del cáncer gástrico, y anti-
M.hy
terapia o la limitación de la señalización NLRP3 podría ser enfoque eficaz para el control de del progreso del cáncer gástrico

Visto:. Xu Y, Li H, Chen W, Yao X, Y Xing, Wang X, et al. (2013)
Mycoplasma hyorhinis
Activa la NLRP3 inflamasoma y promueve la migración y la invasión de células de cáncer gástrico. PLoS ONE 8 (11): e77955. doi: 10.1371 /journal.pone.0077955

Editor: Suresh Yenugu, Universidad de Hyderabad, India

Recibido: 5 de Junio, 2013; Aceptado: September 6, 2013; Publicado: 6 Noviembre 2013

Derechos de Autor © 2013 Xu et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Financiación:. Este trabajo fue apoyado por becas de 100 Programa Talento de la Academia china de Ciencias, la Fundación de Ciencias Naturales de china (91029707, 31170868), fundación de Shanghai de Ciencias Naturales (11ZR1442600), Fundación de Investigación de Novo Nordisk-CAS, Programa de becas SA-SIB, así como becas de los programas nacionales esenciales sobre Enfermedades Infecciosas (2012ZX10002007-003). Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:.. Los autores han declarado que no existen intereses en competencia

Introducción

los micoplasmas son libres de pared organismos pleomórficos, procariotas, ya sea que residen en las membranas de las células eucariotas o dentro de las células, y son los organismos más pequeños capaces de autorreplicación [1]. Hasta la fecha, al menos 16 especies de micoplasmas se han aislado de los seres humanos [2].
Mycoplasma hyorhinis gratis (
M.hy
) se consideró no patógeno para los seres humanos, ya que normalmente infecta a los cerdos que conduce a la enfermedad de las vías respiratorias y la inflamación del pecho y articulaciones [3], [4] . Sin embargo, la evidencia acumulada sugiere que
M.hy
la infección en los seres humanos da lugar a resultados clínicos.
M.hy
se encontró en el 56% de carcinoma gástrico, el 55% de los carcinomas de colon y el 52,6% de las biopsias de carcinoma de pulmón [5]. Por otra parte, 36% de hombres con hiperplasia benigna de próstata (HBP) y 52% de hombres con cáncer de próstata son
M.hy
sero-positivo. Estos hallazgos clínicos sugieren una posible conexión entre los
M.hy
exposición con gástrico, de colon, de pulmón y de próstata [5], [6].

Tras la infección microbiana, modelo de acogida receptores de reconocimiento ( RRP) como TLRs sentido, los agentes patógenos y activar la síntesis de citoquinas pro-inflamatorias tales como la pro-IL-1β y pro-IL-18 a través de la activación de NF-kB. Al mismo tiempo, otro grupo de PRRs incluyendo NLRP3 reclutar la ASC proteína adaptadora y conducir a la activación de caspasa-1, que es una proteasa activa que escinde la forma precursora de citoquinas incluyendo pro-IL-1β y pro-IL-18 en forma madura, secretada [7]. Patógenos o agentes desafiantes provocan la salida de potasio, el daño mitocondrial, la liberación de ADN mitocondrial, la producción de ROS, aumento de calcio intracelular o celular disminución del AMP cíclico en las células inmunes innatas, los cuales están involucrados en la activación de la caspasa-1 [8], [9], [10 ], [11], [12], [13]. Durante este proceso, el NLRP3, ASC y pro-caspasa-1 forma una plataforma molecular llamada inflamasoma. Hasta el momento, un número de inflamosomas han sido identificados, de ellos, el inflamasoma NLRP3 se ha encontrado asociada con el desarrollo de tumores [14], [15], aunque existe controversia de diferentes modelos [16], [17]. No obstante, se informó de IL-1β para promover el crecimiento de células tumorales y la metástasis mediante la inducción de varios genes pro-metastásicos, tales como metaloproteinasas de la matriz y moléculas de adhesión endoteliales, así como TGF-β, quimiocinas y factores de crecimiento [18]. En una población de Corea, la combinación de una mayor nivel de IL-1β de la mucosa y la homocigosis para la IL-1β -31T polimorfismo de un solo nucleótido (SNP) se asocian con un aumento del riesgo de cáncer gástrico [18]. Además, Tu et al. se encontró que la expresión de estómago específico de IL-1β humana en ratones transgénicos condujo a la inflamación gástrica espontánea y el cáncer [19], lo que sugiere que la IL-1β puede promover la carcinogénesis gástrica humana. Por el contrario, IL-18 aumenta la actividad de las células NK, reduce la tumorigénesis, induce la apoptosis y la inhibe la angiogénesis en las células tumorales para ejercer efectos anti-tumorales [20], [21]. Además, se encontró una producción inadecuada de IL-18 para contribuir a la patogénesis de los cánceres y puede influir en el resultado clínico de los pacientes [22]. IL-18 se informó para estimular la producción de matriz de metaloproteasa-9, lo que resulta en aumento de la migración y la invasión en la arteria coronaria células musculares lisas y células HL-60 de leucemia mieloide [23], [24]. También se informó que el suero nivel de IL-18 en el grupo de pacientes con cáncer gástrico fue significativamente más alta que en la úlcera gástrica grupo de pacientes [25] y la IL-18 puede aumentar la metástasis y el escape inmunológico de cáncer de estómago a través de la regulación por disminución de CD70 y mantenimiento de CD44 en la línea celular de cáncer gástrico humano NCI-N87 y SNU16 [26]. También es un mediador crítico de la migración VEGF-mejorado en líneas celulares de cáncer gástrico humano SNU-601 [27]. Los resultados anteriores sugieren que
Mycoplasma hyorhinis
puede promover la migración y la invasión de células de cáncer gástrico mediante la activación de inflamasoma.

Hasta la fecha, un amplio espectro de microbios incluyendo virus, bacterias, hongos y protozoos han sido identificado para activar el inflamasoma NLRP3 [28]. Un estudio reciente mostró que
Mycoplasma pneumoniae
también fue capaz de inducir la producción de IL-1β en las células humanas [29]. Sin embargo, si
M.hy
, que es un factor importante en el desarrollo del cáncer gástrico como se mencionó anteriormente [5], [30], [31], se activa el inflamasoma NLRP3 y si esta activación contribuye a la cáncer gástrico el desarrollo siguen siendo desconocidos. En este estudio, se encontró que los
M.hy
desencadena la secreción de IL-1β de una manera dependiente de inflamasoma NLRP3, y la consiguiente migración inducida por IL-1β y la invasión de células de cáncer gástrico.

resultados


M.hy
disparadores IL-1β e IL-18 Producción de células THP-1

Para determinar si
M.hy
induce IL -1β la producción de células inmunes innatas, que supervisa maduros niveles de IL-1ß en la línea celular de monocitos humanos THP-1 células estimuladas con diferentes cantidades de
M.hy
. En este experimento, una fuerte inducción de IL-1β de una manera dependiente de la dosis se observó (Figura 1A). A continuación, se midieron los niveles de pro-IL-1β de ARNm en las células y los niveles de proteína IL-1β madura en los sobrenadantes de cultivo en diferentes puntos de tiempo después de
M.hy
desafío. Se observó que los niveles de IL-1β de ARNm alcanzaron un máximo de 3 horas después de la exposición (Figura 1B) y maduro IL-1β (Figura 1C) y los niveles de proteína IL-18 (Figura 1D) alcanzó su punto máximo a las 12 horas después del desafío. Por otra parte, macrófagos THP-1 derivadas también mostraron secreción robusta de IL-1β, IL-18, así como otras citoquinas inflamatorias tales como IL-6 y IL-8 (Figura 1E, la Figura S1). Para confirmar los resultados anteriores en THP-1 línea celular, se analizó la producción de IL-1β en monocitos humanos primarios de donantes sanos expuestos a
M.hy
, en el que la IL-1β también fue fuertemente inducidos (Figura 1F) . Estos datos indicaron que
M.hy
desencadenó robusta IL-1β e IL-18 secreción de las células mieloides humanas.

A, 5 × 10
4 células THP-1 fueron tratados con
M.hy
a diferentes dosis, 12 horas más tarde se recogieron los sobrenadantes para ELISA IL-1β. BD, 2 × 10
5 células THP-1 fueron tratados con
M.hy
a una concentración de 6,7 x 10
7 /ml, las células CCU y los sobrenadantes se recogieron en diferentes puntos de tiempo para mRNA de IL-1β (B) y la detección (D) IL-1β (C), así como la proteína IL-18 por tiempo real, PCR y ELISA como se indica. E-F, 5 × 10
4 macrófagos inducida por PMA (E) y los monocitos primarios humanos (F) fueron tratados con
M.hy
, 12 horas más tarde se recogieron los sobrenadantes de citoquinas ELISA. Los valores representan la media ± la desviación estándar (DE) de tres experimentos independientes. *** Representa P & lt; 0,001, ** representa P & lt; 0,01 y * representa p. & Lt; 0,05 en comparación con el control en el análisis estadístico de

LAMP se deriva de
M.hy
es responsable de la inducción de IL-1β a través de TLR2

a continuación se investigó si se requiere la replicación de
M.hy Opiniones de la producción de IL-1β en monocitos. Como se muestra en la Figura 2A,
M

.hy
inactivado por calentamiento o ultra-violeta tratamiento (UV) inducida por la secreción de IL-1β mucho a partir de células THP-1 como en vivo
M .hy
. Esto indicó que ciertos componentes resistentes al calor ya los rayos UV de
M.hy
fue responsable de la inducción de la secreción de IL-1β. Lipid asociada a la proteína de membrana (LAMP) se expresa abundantemente en la superficie de
M.hy
[32], y el estudio anterior encontró que las lipoproteínas de membrana de otras especies de micoplasmas inducida por IL-1β secreción de [33]. por tanto, se especuló que
Lámpara M.hy
derivados (mLAMP) pueden ser responsables de la inducción de IL-1β en las células THP-1. a continuación, se extrajeron de la lámpara del
M.hy gratis (Figura 2B) y puesto a prueba la capacidad de mLAMP para inducir la secreción de IL-1β en las células THP-1. Se encontró que mLAMP claramente induce la secreción de IL-1β en una forma dependiente de la dosis, mientras que la fase acuosa de
M.hy
extracto no fue capaz de hacerlo (Figura 2C). Para excluir la posibilidad de ARN y /o la contaminación de ADN en mLAMP, se trataron los MLAPMs con RNasa y DNasa y se encontró que era mLAMP el componente principal para la inducción de IL-1β (Figura S2).

A, 5 × 10
4 células THP-1 fueron tratados con irradiación de calor o ultravioleta inactivado
M.hy Opiniones de se recogieron 6 horas y los sobrenadantes de IL-1β ELISA. B, proteína total de
M.hy
, mLAMP extrae de
M.hy
y la proteína acuosa se detectó por SDS-PAGE y tinción con plata. C, 5 × 10
4 células THP-1 se trataron con mLAMP a diferentes concentraciones y acuosa, 6 horas más tarde, los sobrenadantes se recogieron para ELISA IL-1β. D, 5 × 10
4 células THP-1 fueron pre-incubadas con las cantidades indicadas de mAb T2.5 o CONT2 (g /ml) durante 0,5 horas y desafió con TLR2 ligando P3CSK4 (control positivo), TLR4 LPS ligando (control negativo) y
M.hy
a una concentración de 6,7 × 10
7 CCU /ml posteriormente durante 6 horas, los sobrenadantes se recogieron para ELISA IL-1β. Los valores representan la media ± la desviación estándar de tres experimentos independientes. *** Representa P & lt; 0,001, ** representa P & lt; 0,01 y * representa p. & Lt; 0,05 en comparación con el control en el análisis estadístico de

Se informó que mLAMP activa principalmente a través de NF-kB y TLR2 TLR6 [34], [35]. Por lo tanto, se aplicó primero una T2.5 anticuerpo neutralizante TLR2 para bloquear la señal de TLR2, con CONT2 que sirve como un control de isotipo [36]. Como se muestra en la Figura 2D, T2.5 bloqueó completamente la secreción de IL-1β estimulada por agonista TLR2 P3CSK4 pero no por los LPS ligando TLR4. Es importante destacar que la secreción de IL-1β de
M.hy
células infectadas se redujo fuertemente por T2.5, lo que indica que TLR2 participó en mLAMP desencadenado la secreción de IL-1β en monocitos humanos. Curiosamente, la secreción de IL-1β a partir de células
M.hy
ha infectado no fue completamente bloqueado por T2.5 (Figura 2D), lo que sugiere que la vía de señalización de TLR2 independiente también participó en mLAMP desencadena la secreción de IL-1β, que merece una mayor investigación en el futuro.


M.hy
induce la secreción de IL-1β través de la activación de la NLRP3 inflamasoma

Para probar si
M.hy
inducida por la secreción de IL-1β través de la activación inflamasoma, primero se utilizó LPS cebó macrófagos THP-1 derivadas para comprobar si
M.hy
puede activar inflamasoma como ATP o MSU, que son conocidos activadores inflamosoma. Como se muestra en la Figura 3A,
M

.hy
fue capaz de inducir la liberación de IL-1β en las células cebadas. A continuación examinamos la escisión de la caspasa-1 y oligomerización de ASC, dos fabricantes importantes para la activación inflamasoma. Hemos encontrado que
M.hy
promueve la escisión de la caspasa-1 y oligomerización de ASC (Figura 3B), lo que indica una activación directa de inflamasoma por
M.hy.

a, 1 × 10
5 macrófagos inducida por PMA se cebaron con 50 ml de LPS /NG, a continuación, tratados con
M.hy
, LPS, MSU o ATP durante 5 horas, los sobrenadantes se recogieron para IL-1β ELISA. B, La escisión de la caspasa-1 y oligomerización de ASC en los lisados ​​reticulados inflamasoma enriquecida y de THP-1 macrófagos derivados tratados con
M.hy
, LPS y MSU durante 6 horas. Los monómeros, dímeros y oligómeros de ASC se indicaron en consecuencia. C, 5 × 10
4 THP-1 fueron pretratados con caspasa-1 inhibidor de la AC-YVAD-CHO y luego desafió con
M.hy
a una concentración de 6,7 x 10
7 CCU /ml, 12 horas más tarde se recogieron los sobrenadantes de IL-1β ELISA. D, el silenciamiento exitosa (knock-down, KD) de la ASC y la caspasa-1 fue verificado por el Western Blot. E, 5 × 10
4 THP-1 scramble, células caspasa-1 KD y células ASC KD fueron tratados con
M.hy
a una concentración de 6,7 x 10
7 CCU /ml, 12 horas más tarde se recogieron los sobrenadantes de IL-1β ELISA. M, 5 × 10
4 células THP-1 fueron pretratados con NLRP3 inhibidor inflamasoma glibenclamida y luego desafiados con
M.hy
, 12 horas más tarde se recogieron los sobrenadantes para ELISA IL-1β. G, el silenciamiento exitosa de NLRP3 se verificó mediante Western Blot. H, 5 × 10
4 células THP-1 revueltos y NLRP3 KD fueron tratados con
M.hy
a una concentración de 6,7 x 10
7 CCU /ml, 12 horas más tarde, los sobrenadantes se recogidos para IL-1β ELISA. I, análisis de inmunotransferencia de pro-caspasa-1 y madurar forma (P10) de la caspasa-1 y madura de IL-1β (P17) en sobrenadantes y pro-IL-1β (P31) y β-actina en extractos de células de THP-1 scramble células y la caspasa-1 KD, ASC KD y KD NLRP3 tratados con
M.hy Opiniones de 6 horas. Los datos presentados son la media ± SD de un representante de cada tres experimentos independientes. *** Representa P. & Lt; 0,001 en comparación con el control en el análisis estadístico de

Además, hemos probado si
M.hy
ha inducido la secreción de IL-1β dependía de ciertos componentes inflamosoma. En primer lugar, se encontró que el específico de caspasa-1 inhibidor de AC-YVAD-CHO disminución de la secreción de IL-1β en las células THP-1 de una manera dependiente de la dosis (Figura 3C). A continuación, cuando se empleó específica shRNA para silenciar la expresión de caspasa-1 y ASC (Figura 3D), la producción de IL-1β se vio fuertemente disminuida a
M.hy
desafío (Figura 3E), lo que indica que
M.hy
induce la secreción de IL-1β fue dependiente de caspasa-1 y ASC.

a continuación, hemos probado si se requiere NLRP3 para
M.hy
inducida por la secreción de IL-1β. En primer lugar, se encontró que el inhibidor de NLRP3 glibenclamida suprime la secreción de IL-1β
M.hy
ha inducido de una manera dependiente de la dosis (Figura 3F) [37]. Cuando se empleó específica shRNA para silenciar la expresión de NLRP3 (Figura 3G), la producción de IL-1β se vio fuertemente disminuida a
M.hy
desafío (Figura 3H), lo que indica que
M.hy
inducida por la secreción de IL-1β dependía de NLRP3. Esto fue confirmado por inmunotransferencia, en el que la producción de caspasa-1 de activación y IL-1β eran ambos NLRP3 dependiente (Figura 3I). Por otra parte, hemos encontrado, además, que mLAMP era el componente principal responsable de la activación inflamasoma NLRP3 por
M.hy gratis (Figura S2C). Además, se informó AIM2 inflamasoma para ser activado por el ADN [38], y encontramos que
M.hy
ADN inducida por la secreción de IL-1β a través de AIM2 inflamasoma (Figura S3 A). Curiosamente,
M.hy
ha inducido la secreción de IL-1β dependía principalmente de NLRP3, mientras AIM2 era sólo parcialmente implicados (Figura S3 A). Tomados en conjunto, estos resultados demostraron claramente que
M.hy
induce la secreción de IL-1β través de la activación de la inflamasoma NLRP3 en las células monocíticas humanas.

mecanismos subyacentes
M.hy
Triggered NLRP3 inflamasoma activación

la activación de NLRP3 inflamasoma por una variedad de estímulos depende de la actividad catepsina B, K
+ de flujo de salida, la entrada de calcio y /o la producción de especies reactivas de oxígeno (ROS) [11], [ ,,,0],12], [13], [39]. Para explorar los mecanismos subyacentes a la liberación de IL-1β en respuesta a
M.hy
desafío, se aplicó primer inhibidor de la CA-074 catepsina B-específica de mí y observó una atenuación significativa de la secreción de IL-1β en
M .hy
desafío. A una concentración de 100 mM, CA-074 Me completamente bloqueado IL-1β de liberación (figura 4A). Esta inhibición no se debió a un efecto tóxico para las células como IL-8 secreción afectados por este inhibidor era muy suave (Figura 4E). Es importante destacar que, cuando las células se trataron con la catepsina K inhibidor I, la disminución de la secreción de IL-1β no era evidente en absoluto (Figura 4B y 4F), lo que sugiere que la actividad de la catepsina B estaba implicado específicamente en la activación inflamasoma NLRP3 durante
M .hy
desafío. Además, cuando bloqueamos K
+ flujo de salida mediante el aumento de la K extracelular
+ concentración, la secreción de IL-1β por THP-1 células tras
M.hy
desafío se redujo significativamente en una dosis de manera dependiente (Figura 4C). Una vez más, no había efecto tóxico de KCL como IL-8 de producción de las mismas células fue normal (Figura 4G). Para averiguar si la entrada de calcio ayudó activación inflamasoma, hemos añadido diferentes dosis de EGTA en el medio de cultivo celular y se encontró que el tratamiento EGTA bloqueado
M.hy
inducida por la secreción de IL-1β de una manera dependiente de la dosis, y no se observó ningún efecto tóxico de EGTA como se evidencia por IL-8 de producción (Figura 4D y 4H).

5 × 10
4 THP-1 fueron pretratados con diferentes dosis de la catepsina B inhibidor de CA-074 Me (a, E) o de la catepsina K inhibidor I (B, F), KCL (C, G) o EGTA (D, H), a continuación se expusieron a
M.hy
a una concentración de 6,7 × 10
7 CCU /ml, 6 horas más tarde, los sobrenadantes se recogieron para IL-8 e IL-1β ELISA al mismo tiempo. Los datos presentados son la media ± SD de un representante de cada tres experimentos independientes. *** Representa P & lt; 0,001, ** representa P & lt; 0,01 y * representa p. & Lt; 0,05 en comparación con el control en el análisis estadístico de

Además, hemos probado si
M.hy
desafío inducida por la generación de ROS en las células THP-1. Para este ensayo, las células THP-1 se cargaron primero con el fluoróforo sensible a redox DCFDA y luego desafiados con
M.hy
, ATP se incluyó como control positivo. Como se muestra en la Figura 5A, se detectaron 16,9% de células CM-H2DCFDA positivos 30 minutos después de
M.hy
tratamiento en comparación con 1,6% en las células no tratadas. Estos datos sugirieron que ROS puede contribuir a la activación inflamasoma NLRP3 en respuesta a
M.hy
desafío. Para comprobar esta posibilidad, pretratados células THP-1 con difenil-inhibidor ROS (DPI) durante 30 minutos y, a continuación, el desafío de las células con
M.hy
antes de la medición de la IL-1β producción de 6 horas más tarde. Como era de esperar, el DIP reduce drásticamente
M.hy
ha inducido la liberación de IL-1β (Figura 5B). Un estudio reciente mostró que el inhibidor de ROS como DPI abolió la liberación de IL-1β en macrófagos de ratón mediante la inhibición de la expresión génica NLRP3 [40]. Por lo tanto, también supervisó el nivel de ARNm de la pro-IL-1β y NLRP3 bajo tratamiento DPI. Se encontró que el DPI reduce notablemente la expresión de pro-IL-1β y NLRP3 (Figura 5C-D), que era consistente con el hallazgo de células de ratón [40]. Además, también examinamos la activación de la caspasa-1 y se encontró que dosis bajas (1 o 10 mM) de tratamiento DPI no afectó a la activación de la caspasa-1, mientras que 100 M de DPI inhibió la caspasa-1 de activación (Figura 5E). Esto demostró que en las células humanas DPI interfería con la activación inflamasoma NLRP3 través de la inhibición de la transcripción NLRP3, así como la actividad de caspasa-1 cuando se aplicó la dosis alta. En conjunto, estos datos sugieren que la actividad de la catepsina B, K
+ flujo de salida, Ca
2 + afluencia y ROS todos contribuyeron a la activación inflamasoma NLRP3 en respuesta a
M.hy
desafío.

A, los niveles de ROS en
M.hy
trataron células THP-1 se analizaron por medio del etiquetado CM-H2DCFDA. Los datos representan media del porcentaje de células CM-H2DCFDA-positivos. B, 5 × 10
fueron pre-incubadas con las cantidades indicadas de DPI durante 0,5 horas y desafió con
M.hy
posteriormente durante 6 horas, los sobrenadantes se cosecharon 4 células THP-1 de la IL 1β ELISA. 1 × 10
5 células THP-1 (C) y macrófagos inducidos PMA (D) se pre-incubaron con las cantidades indicadas de DPI durante 0,5 horas y desafiados con
M.hy gratis (concentración final, 6,7 × 10
7 CCU /ml) a continuación durante 3 horas, las células se lisaron y el ARNm se extrajeron para la síntesis de cDNA y, finalmente, para la IL-1β y la expresión génica NLRP3 por PCR en tiempo real. E, análisis por inmunotransferencia de pro-caspasa-1 y madurar forma (P10) de la caspasa-1 y IL-1β madura (P17) en sobrenadantes y extractos de macrófagos THP-1 derivadas tratados con
M.hy
para 6 horas después de DPI pretratamiento durante 0,5 horas. Los datos presentados son la media ± SD de un representante de cada tres experimentos independientes.


M.hy
Activa NLRP3 inflamasoma
in vivo

cuando las células dendríticas derivadas de médula ósea de ratón (BMDCs) se infectaron con
M.hy
, una inducción de IL-1β sostenida se observó (Figura 6A). Otros experimentos en BMDCs aislados de tipo salvaje (WT) o ratones deficientes en caspasa-1, ASC o NLRP3 con
confirmó M.hy
reto que
M.hy
inducción de IL 1β fue NLRP3 inflamasoma dependiente (Figura 6B). Además, la inoculación sistémica de
M.hy
en ratones WT indujo la producción de IL-1β en el suero y el líquido de lavado peritoneal (PLF), pero no en ratones que carecen de ASC o NLRP3 (Figura 6C-D). Curiosamente, el nivel basal de IL-1β en ratones deficientes ASC era claramente más alta que en los ratones deficientes WT o NLRP3, pero reto con
M.hy
no aumentar más la secreción de IL-1β en tales ratones (Figura 6C-D). En conjunto, estos resultados confirmaron que los
M.hy también
activa NLRP3 inflamasoma en ratones
in vitro en
y
in vivo
.

A, 1 × 10
5 médula ósea de ratón las células dendríticas derivadas (BMDCs) se expusieron a
M.hy
a una concentración final de 5 × 10
7 CCU /ml a diferentes puntos de tiempo, se recogieron los sobrenadantes de IL -1β ELISA. B, 1 × 10
5 BMDCs aislados de tipo salvaje y la caspasa-1 deficiente (knock-out, KO), ASC KO y NLRP3 ratón KO se expusieron a
M.hy
a una concentración final de 5 × 10
7 CCU /ml, 24 horas más tarde, los sobrenadantes se recogieron para la IL-1β ELISA. i.p. C-D, C57BL /6, se inyectaron ratones KO ASC y NLRP3 KO con 5 × 10
8 CCU /ml de
M.hy
en 200 l de PBS. Los ratones se sacrificaron 6 horas después de la inyección, y suero o fluido de lavado peritoneal (PLF) se recogieron para la IL-1β ELISA (C, D). El experimento se repitió tres veces, y los datos se agruparon y se mostró como media ± DE. *** Representa P & lt; 0,001 y representa ** P & lt;. 0,01 en comparación con el control en el análisis estadístico de


M.hy
inducida por IL-1β promueve la migración celular y tumor gástrico invasión

Los datos anteriores mostraron claramente que
M.hy
era capaz de inducir la producción de IL-1β a partir de células inmunes innatas través de la activación inflamasoma NLRP3. Los primeros estudios epidemiológicos revelaron un posible papel de micoplasma en el desarrollo de cáncer gástrico [5]. Y
Mycoplasma hyorhinis
fue demostrado para promover la migración de células tumorales, invasión y metástasis
in vitro
y
in vivo
[41]. La hipótesis de que puede existir otro mecanismo para esta promoción, que es que
M.hy
puede promover la carcinogénesis y /o metástasis gástrica mediante la promoción de la producción de IL-1β. Y confirmamos que
M.hy
ha promovido la migración celular y la invasión de cáncer gástrico (Figura S5). Desde
M.hy
se demostró para infectar células de cáncer gástrico ([41], la figura S4), por lo que es posible que
M.hy
puede inducir la activación inflamasoma en las células cancerosas directamente. Sin embargo, no se detectó activación inflamasoma en células de cáncer gástrico (Figura S6)
.
Determinamos siguiente el efecto de la IL-1β recombinante (rIL-1β) sobre la carcinogénesis de células de cáncer gástrico en un ensayo de formación de colonias, que reveló que la rIL-1β no influyó en la proliferación de la línea celular de cáncer gástrico MGC-803 (Figura S7). Desde que se informó de la IL-1β para promover la metástasis de otros tumores [18], hemos comprobado los efectos de RIL-1β en la migración y la invasión de las células MGC-803. Nuestros resultados muestran que la migración MGC-803 y la invasión se mejoraron con el tratamiento rIL-1β (Figura 7A y 7C), mientras que el tratamiento con rIL-18 no mostró ningún efecto (Figura 7B y 7D). A continuación, se trataron estas células de cáncer gástrico con los sobrenadantes de cultivo de
M.hy
ha desafiado THP-1 macrófagos o macrófagos derivados con silenciamiento de NLRP3, ASC y la caspasa-1 para la migración y la invasión de ensayo. Nuestros resultados muestran que los sobrenadantes de cultivo de
M.hy
desafiaron células de macrófagos scramble migración y la invasión de células de cáncer gástrico mejoradas fuertemente, mientras que los sobrenadantes de cultivo de la NLRP3, ASC o caspasa-1 macrófagos desmontables no lo hicieron, probablemente debido a la disminución de la secreción de IL-1β (Figura 8A y 8C). Este aumento de la migración y la invasión de células MGC-803 fue suprimida por el tratamiento de las células con anti-IL-1β mAb (Figura 8B y 8D). Tomados en conjunto, nuestros resultados demostraron que
M.hy
inducen la migración y la invasión de la línea celular de cáncer gástrico MGC-803 mediante la promoción de la secreción de IL-1β a partir de células monocíticas. Por otra parte, nuestros datos indican que
M.hy
inducida por la activación inflamasoma puede promover
M.hy
replicación (Figura S8), lo que puede crear una retroalimentación positiva y finalmente conduce a la cronicidad de la enfermedad.

5 × 10
4 células MGC-803 tratadas con dosis indicadas de IL-1β (A y C) o IL-18 (B y D) fueron analizados por los ensayos de migración e invasión Transwell. La parte superior se migraron o invadieron las células y la más baja eran los números promedio de 4 campos microscópicos para cada experimento correspondiente, respectivamente. Los datos son representativos de tres experimentos independientes y las barras de error representan SD. *** Representa P & lt; 0,001 en comparación con el control en el análisis estadístico de

A-B, 5 × 10
4 células MGC-803 tratados con SN de los macrófagos revueltos como control, y el SNS. de
M.hy
ha tratado Casp-1 KD, ASC kd y KD NLRP3 macrófagos fueron analizados por la migración Transwell (A) y ensayos de invasión (B). C-D, 5 × 10
4 células MGC-803 tratadas con SNs de
M.hy
tratados macrófagos THP-1 o SNs que contienen anti-IL-1β mAb fueron analizados por la migración Transwell derivados (C ) y la invasión (D) ensayos. Los paneles superiores se migran o invadieron las células y los paneles inferiores son números promedio de 4 campos microscópicos para cada uno de los experimentos correspondientes, respectivamente. Los datos son representativos de tres experimentos independientes y las barras de error representan SD. *** Representa P & lt; 0,001, ** representa P & lt; 0,01 y * representa p. & Lt; 0,05 en comparación con el control en el análisis estadístico de

Discusión

Los micoplasmas se distinguen de otras bacterias por su pequeño tamaño, genoma minutos y la falta de la pared celular. Muchos micoplasmas establecer la colonización e infección a través de la adhesión a los tejidos del huésped. Debido a su arquitectura superficial dinámica es antigénicamente y funcionalmente versátil, micoplasmas son capaces de evadir el ataque inmune de acogida y la adaptación a diversos hábitats y causan enfermedades crónicas [32]. Desde la identificación de
M.hy En venta porcina en 1962, poca investigación se llevó a cabo en este patógeno hasta que fue encontrado para ser asociado con varios cánceres humanos [5], [41], [42], [ ,,,0],43]. Más recientemente, los científicos descubrieron que
M.hy
p37 proteína era responsable de promover la invasividad de las células cancerosas y la metástasis [30], [44]. Además de este mecanismo directo, este microbio también puede inducir la tumorigénesis o metástasis indirectamente a través de un proceso inflamatorio crónico local. Es bien sabido que la IL-1β es una citocina importante pro-inflamatorio que promueve el crecimiento de células de cáncer de colon y mejora la capacidad de invasión y metástasis de las células de melanoma B16 [19], [45]. Se encontró sobreexpresión de IL-1β para inducir la inflamación gástrica y cáncer en ratones [19]. En este estudio, se investigó si la inflamasoma NLRP3, que controla la maduración de IL-1β, fue activado por
M.hy
, y si esta activación puede contribuir a
M.hy servicios asociados metástasis gástrica . Nuestros resultados mostraron que
M.hy
activa inflamasoma NLRP3
in vitro
y
in vivo
, y la promoción de la migración celular de cáncer gástrico y la invasión por
M .hy
era dependiente de la activación inflamasoma NLRP3. Además NLRP3, encontramos que
ADN M.hy
también activó inflamasoma AIM2, pero la activación de mLAMP NLRP3 fue el componente dominante para la inducción de IL-1β por
M.hy.

se informó recientemente de que lipopéptido acilados de micoplasma muertos por calor
Acholeplasma laidlawii gratis (HKAL) inducida por la producción de IL-1β a través NLRP7 inflamasoma en las células humanas, mientras que HKAL inducida total secreción de IL-1β fue parcialmente dependiente NLRP3 [46], lo que indica que múltiples inflamosomas pueden ser activados por cierto micoplasma. Nuestros datos no descartan la posible implicación de NLRP7 en
M.hy
inducen la producción de IL-1β, pero
M.hy
principalmente activa inflamasoma NLRP3, debido a que la secreción de IL-1β fue casi completamente abolidos en las células NLRP3 silenciada (Figura 3H y 3I).

los primeros estudios proponen que las ROS activa inflamasoma NLRP3 mediante la activación de la caspasa-1 [47]. Sin embargo, la investigación reciente mostró que los inhibidores de ROS interfirieron con la transcripción de IL-1β y NLRP3, pero no la activación afectada de la caspasa-1 en células de ratón [40]. GCCTATTATTGCTAAAGATAAATATCTTAAGGTATTTTAATATTGGTAATCTATTTTAGAAATTTAATTTAAAAATTAAACTCGGTTATAAAAAAGATCGTTGAAATAATAAATATGAAGTTAATCATATTGTTATTTGCTATTCAGTTTTCAAAGAACTATAATTGAGAACTTAAAGCTCTCAAAACTAGACACGAATCGATTATGTAATAAGTCAATTAAGACTAACGGAAAGCGGAAAAAGAAGGTGATCCGTCCCCACG.

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]