Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: Proteína Asociada BAI1-2-Al igual que 1 (BAIAP2L1) es un biomarcador potencial en el cáncer de ovario
PLOS ONE: Proteína Asociada BAI1-2-Al igual que 1 (BAIAP2L1) es un biomarcador potencial en el cáncer de ovario

2015/8/30


Extracto

-Brain específico inhibidor de la angiogénesis 1 (BAI1) proteína -asociado 2-como 1 (BAIAP2L1), también conocido como sustrato de la tirosina quinasa del receptor de insulina (IRTKS), está involucrado en la protrusión de la membrana plasmática y la actina formación durante la morfogénesis y la migración celular. BAIAP2L1 se informó recientemente para promover la proliferación celular a través de la activación de la vía EGFR-ERK en el carcinoma hepatocelular. En este estudio, se presenta el primer estudio exhaustivo de BAIAP2L1 regulación al alza en el cáncer de ovario humano. La regulación positiva de BAIAP2L1 en tumores de ovario se encontró por primera vez durante la detección del ARN y confirmado por estudios inmunohistoquímicos en los cánceres de ovario y otros tipos de cáncer. regulación al alza significativa de BAIAP2L1 en cáncer de ovario se validó mediante el análisis de múltiples cohortes independientes de los conjuntos de datos disponibles públicamente. Por otra parte, la expresión de proteínas en BAIAP2L1 lesiones metastásicas fue mayor que los tumores primarios correspondientes. Los ensayos funcionales en células de cáncer de ovario reveló que BAIAP2L1 está involucrado en la promoción de la proliferación celular y evitar la apoptosis. En conclusión, los resultados de este estudio no sólo indican que BAIAP2L1 se puede utilizar como un biomarcador de cáncer de ovario humano, pero también revelan su papel en la biología del cáncer. Aclarar en mayor medida el papel de BAIAP2L1 en el contexto de las vías de señalización de las células de cáncer receptor de la insulina está garantizado para el desarrollo de la terapéutica del cáncer atacando el metabolismo específico del cáncer

Visto:. Un Chao, Tsai CL, Jung SM, Chuang WC , Kao C, Hsu A, et al. (2015) BAI1 asociada a la proteína 2-Al igual que 1 (BAIAP2L1) es un biomarcador potencial en el cáncer de ovario. PLoS ONE 10 (7): e0133081. doi: 10.1371 /journal.pone.0133081

Editor: David Wai Chan, la Universidad de Hong Kong, Hong Kong

Recibido: 27 Marzo, 2015; Aceptado: 22 Junio ​​2015; Publicado: July 29, 2015

Derechos de Autor © 2015 Chao et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Disponibilidad de datos: Todos los datos relevantes están dentro del apoyo de sus archivos de información en papel y

Financiación:. Este trabajo fue financiado por Chang Gung Medical Foundation: CMRPG3E0391 (Chao A), CMRPG3C1621-2 (Tsai CL), CMRPG3C0281-3, y CMRPG3C0941-2 CRRPG3D0031 (Wang TH). Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:. Los autores de este manuscrito tener los siguientes intereses en competencia: Yi-Chao Lee es uno de los inventores de la patente estadounidense nº 7192709B2, fechada el 20 mar, 2007, cesionario de Digigenomics Co, Ltd los autores han declarado que no existen intereses en competencia

Introducción
cáncer de ovario
epitelial. es la causa principal de muerte en los tumores malignos ginecológicos [1]. Es, junto con carcinoma peritoneal y el carcinoma de las trompas de Falopio, la novena muerte más común en las mujeres en Taiwán [2]. La supervivencia global del cáncer de ovario sigue siendo pobre a pesar de las mejoras en el tratamiento del cáncer de ovario [3,4]. El diagnóstico típico de finales de cáncer de ovario, cuando la enfermedad ya se ha extendido más allá de la pelvis en el momento de la presentación clínica, es parte de la razón de su mal resultado [5]. La detección inmunológica de antígeno de cáncer en suero CA125 [6] se ha integrado en una práctica estándar para el diagnóstico de masas ováricas [7]. CA125 también es útil para el seguimiento de la respuesta y facilitar la vigilancia de pacientes con cáncer de ovario [8]. Sin embargo, el nivel de CA125, con una sensibilidad del 80%, no es elevada en todos los tumores de ovario, y la especificidad puede verse afectada por otros tumores malignos, las condiciones fisiológicas, y la endometriosis [9]. Por lo tanto, es necesaria la identificación de marcadores adicionales con urgencia para complementar CA125 para la detección precoz, la evaluación del tratamiento y evaluar el pronóstico de los pacientes con cáncer de ovario
.
BAIAP2L1 /IRTKS (Identificación de genes 55971) se encuentra en el cromosoma 7q21.3 -q22.1. BAIAP2L1 codifica una proteína de 511 aminoácidos con un peso molecular de aproximadamente 57 kD [10,11]. BAIAP2L1, junto con BAIAP2 (IRSp53), BAIAP2L2 (FLJ22582), pertenecen a la familia IRSp53, y todos ellos comparten el IMD (IRSp53 y Missing-en el dominio de la metástasis) y el dominio SH3 [12]. El dominio IMD pertenece a la familia más grande del dominio Bin-Amphipsin-Rev167 (BAR) [12], y el dominio BAR forma una membrana en forma de media luna que se puede unir dimmer altamente curvada, con carga negativa [13]. Además, el IMD ha actina capacidad de unión de filamento [12]. El dominio SH3 es conocido por múltiples interacciones proteína-proteína [14]. Por lo tanto, los miembros de la familia IRSp53 son vistos como proteínas de andamiaje o adaptadores que ayudan al montaje de los complejos de proteínas de los filamentos de actina a la membrana o con una curvatura específica.

BAIAP2L1 puede modular grupos de haces de actina cortos durante movimiento de las células [15]. En enterohemorrágica
Escherichia coli
, muchos de los informes sobre BAIAP2L1 pertenecen a su similitud con BAIAP2 en salientes de membrana ricas en actina, llamados pedestales [16,17,18,19]. En células de mamíferos, BAIAP2L1 también se ha relacionado con la migración Src-dependiente de células [14,19,20] y MDM2-p53 mediada por ubiquitinación [21]. En la tumorigénesis, BAIAP2L1 ha informado para promover la proliferación celular a través de la activación de la vía EGFR-ERK en el carcinoma hepatocelular [22]. receptor de FGF oncogénico gen 3 (FGFR3) -BAIAP2L1 fusión se identificó en los cánceres de vejiga [23] y el cáncer de pulmón [24], y su identificación puede ayudar en la selección de pacientes para la terapia FGFR-dirigida. Hasta la fecha, el papel de BAIAP2L1 en cáncer de ovario no se ha definido.

Se presenta aquí el primer estudio exhaustivo de BAIAP2L1 regulación al alza en los cánceres de ovario. La regulación positiva de BAIAP2L1 en tumores de ovario fue revelado por primera vez en Clontech cáncer de perfiles de matriz y se confirma con los estudios de inmunohistoquímica. conjuntos de datos de dominio público se utilizaron para validar que la expresión de BAIAP2L1 es significativamente mayor en el cáncer de ovario que los tejidos normales y otros tipos de cáncer. Los ensayos funcionales en células de cáncer de ovario indican que BAIAP2L1 está involucrado en la promoción de la proliferación celular y evitar la apoptosis. Estos resultados sugieren que la regulación al alza de BAIAP2L1 puede ser utilizado como un biomarcador potencial en el cáncer de ovario.

Material y Métodos

Análisis de microarrays de genes expresados ​​diferencialmente

microarrays de oligonucleótidos que contienen 18861 sondas (Compugen Inc., Tel Aviv, Israel) se utilizaron para analizar los genes expresados ​​diferencialmente entre el ARN del ovario normal humana (número de catálogo CR0856, Clontech, CA, EE.UU.) y el tumor de ovario humano (número de catálogo 64011-1, Clontech, Palo Alto, CA). Procedimientos de etiquetado y escaneo CyDye fueron similares a los que se informó anteriormente [25]. Entre los genes expresados ​​diferencialmente entre el tumor de ovario y cáncer de ovarios normales, se seleccionó BAIAP2L1 ser validado aún más. El cáncer de perfiles membranas de matriz II (catálogo#7847-1, Clontech, Palo Alto, CA) se hibridaron con la sonda de cDNA radiomarcado para BAIAP2L1. La matriz contiene 154 muestras de diferentes tipos de cáncer de mama, ovario, recto, estómago, pulmón, riñón, vejiga, vulva, próstata, útero, cuello del útero, tiroides, testículos, piel, intestino delgado, páncreas, tráquea, y el hígado ( Fig S1).

El análisis inmunohistoquímico de tejidos tumorales clínicos

tejidos FFPE) tumorales incluidas en parafina (fijadas con formalina de cáncer de ovario se obtuvieron de Chang Gung Memorial hospital. La información clínica de los pacientes fue archivada en el banco de datos del Centro de Investigación del Cáncer Ginecológico, Chang Gung Memorial Hospital, Taiwán. El estudio fue aprobado por el Comité de Ética del Hospital Memorial Chang Gung (IRB No.95-1328B). Se obtuvo el consentimiento informado por escrito del donante o de los familiares para el uso de esta muestra en la investigación. arrays de tejidos comercialmente disponibles incluyen: FDA805-1and 805-2 (Cuadros S1) (US Biomax Inc, Rockville, MD, EE.UU.)., BC 111109, 111110 aC, y OV8011-2-BX (cuadros S2) (US Biomax Inc. , Rockville, MD, EE.UU.).

diapositivas de tejidos FFPE (cáncer de ovario y el ovario normal, cada 4 mm de espesor) se deparaffinized en xileno y rehidratada en la disminución de las concentraciones de etanol. Las secciones se immunostained con un anticuerpo anti-BAIAP2L1 en dilución 1: 1000 usando el Bono-Max automatizado de tinción inmunohistoquímica (Leica, Alemania). La puntuación inmunohistoquímica general (histoscore) en este estudio fue el porcentaje de células positivas multiplicado por su intensidad de la tinción (0 = negativo, 1 = débil, 2 = moderada, 3 = fuerte), y varió de 0 a 300 (100% multiplicado por 3) [26,27].

Cultura y el tratamiento de las líneas celulares

líneas celulares de cáncer de ovario humano (TOV112D, TOV-21G, SKOV3, MDAH2774), células de fibroblastos de pulmón (HFL1), y la aorta células del músculo liso normal (T /G HA-VSMC) se obtuvieron de la American Type Culture Collection (Manassas, VA, EE.UU.). TOV112D, TOV-21G, SKOV3, MDAH2774, y HFL1 se cultivaron en DMEM /F12 con suero bovino fetal al 10% y cantidades apropiadas de penicilina y estreptomicina a 37 ° C con 5% de CO2. T /G células HA-VSMC se cultivaron en DMEM /F12 con 10% de suero fetal bovino, ácido ascórbico 0,05% mg /ml, 0,01 mg /ml de insulina, 0,01 mg /ml de transferrina, 10 ng /selenito de sodio ml, y 0,03 mg /suplemento de crecimiento de células endoteliales ml. Para el análisis de apoptosis, las células transfectadas con siRNA BAIAP2L1 eran o irradiadas con UV (100 J /M
2) o se trataron con 10 mM cisplatino (Fresenius Kabi, NC, EE.UU.) durante 24 horas antes del análisis.

la transfección de interferente pequeño (si) RNA

MDAH2774 y SKOV3 (8000 y 4000 células, respectivamente, en placas de 96 pocillos) fueron transfectadas con 1 picomol de interferente pequeño-BAIAP2L1 (CCCGAATTCACAAAGGGTAAATAAT, Invitrogen, Carlsbad, CA) en Lipofectamine RNAimax (Invitrogen, Carlsbad, CA) de acuerdo con el protocolo del fabricante. Después de 48 h de transfección, la supresión de determinados genes fue confirmada por análisis de Western blot.

extracción de RNA y en tiempo real

El ARN total se aisló con reactivo TRIzol PCR-Q (Invitrogen, Carlsbad, CALIFORNIA). Por RT-qPCR, primera cadena de cDNA fue sintetizado con un oligo-T usando superíndice III primer kit de síntesis de la cadena (Invitrogen, Carlsbad, CA). El nivel de expresión de BAIAP2L1 (cebador directo: CACCCGACTACTTGGAATGCT, cebador inverso: CGTTGGCATCGTTAGGAGC) se cuantificaron utilizando SYBR verde ensayo (Applied Biosystems). deshidrogenasa (GAPDH) la expresión de gliceraldehído-3-fosfato (cebador directo: 5'-GGTATCGTGGAAGGACTCATGAC-3 ', cebador inverso: 5'-ATGCCAGTGAGCTTCCCGT-3') se utilizó como control interno. Los ciclos térmicos fueron las siguientes: desnaturalización inicial a 95 ° C durante 10 min, seguido de 45 ciclos de 95 ° C durante 15 s y 60 ° C durante 1 min. Las reacciones se realizaron en el ABI PRISM 7900 instrumento HT (Applied Biosystems). Los cálculos se realizaron con el ciclo de media de valor umbral (Ct) para cada uno de mediciones por duplicado.

análisis de transferencia de Western

Las células se lisaron en tampón de lisis ensayo de radioinmunoprecipitación enfriado con hielo [1% de Triton X- 100, 1% NP-40, 0.1% SDS, 0.5% DOC, 20 mM Tris-hidroximetil-aminometano (Tris-HCl, pH 7,4), NaCl 150 mM, inhibidores de proteasa (Sigma, St. Louis, MO, EE.UU.), y los inhibidores de la fosfatasa (Sigma, St Louis, MO, EE.UU.)] durante 30 minutos. Después de la separación electroforética en 13% de geles de poliacrilamida con dodecilsulfato de sodio, las proteínas en los geles se transfirieron a membranas de nitrocelulosa (Amersham Pharmacia Biotech, Uppsala, Suecia). Las muestras de proteínas se analizaron utilizando anti-BAIAP2L1 (Abnova, Taipei, Taiwán), anti-caspasa 3 escindida (Tecnología de Señalización Celular, Danvers, MA, EE.UU.), anti-PARP (Tecnología de Señalización Celular, Danvers, MA, EE.UU.) y anti- actina (Santa Cruz Biotechnology, Santa Cruz, CA) como anticuerpos primarios y anticuerpos secundarios conjugados con peroxidasa de rábano picante correspondiente (Santa Cruz Biotechnology, Santa Cruz, CA). Las proteínas marcadas se detectaron posteriormente por un aumento de quimioluminiscencia (ECL, Millipore, y Bradford, MA, EE.UU.). Para cada muestra, las intensidades de banda se normalizaron a beta-actina.

viabilidad de las células de ensayo

Después de desmontables de expresión BAIAP2L1 endógeno con siRNA durante 48 h, la actividad de proliferación celular se midió con 3- (4 , 5-dimetiltiazol-2-il método -2,5 difeniltetrazolio (MTT) (Sigma, M5655-1G)). células MDAH2774 y SKOV3 se sembraron a 8000 y 4000 células /pocillo, respectivamente, en placas de 96 pocillos. concentración de trabajo de solución de MTT fue 1 mg /ml. La densidad óptica se midió usando VICTOR2 Escaneo de múltiples pocillos espectrofotómetro con la absorbancia a 570 nm. Para el ensayo de BrdU, las células de cáncer de ovario BAIAP2L1 desmontables se incubaron con BrdU durante 6 h. actividad de síntesis de ADN fue ensayada mediante BrdU ELISA kit (Roche Applied Science) como se describe anteriormente [26].

Detección de la fusión de genes entre FGFR y BAIAP2L1

El ARN total fue extraído a partir de 8 frescas congeladas tejidos de cáncer de ovario con los protocolos que se informó anteriormente [28]. La detección de gen de fusión FGFR3-BAIAP2L1 se realizó con kits de PCR rápida KAPA2G (Kapabiosystem, Wilmington, MA) en las siguientes condiciones: 95 ° C durante 3 min, seguido de 35 ciclos de 95 ° C durante 30 seg, 53 ° C durante 30 seg y 72 ° C durante 30 segundos, y terminó a 72 ° C durante 10 minutos. Los cebadores de PCR se informó anteriormente [24]. El ARN de las células SW780 de cáncer de vejiga se utilizó como control positivo para la detección del gen de fusión FGFR3-BAIAP2L1 [23].

El análisis de datos de microarrays en bases de datos públicamente disponibles

Los datos con el número de serie GSE14407 [29], GSE2109, y GSE36133 [30] fueron recuperados de la Expresión génica Omnibus (GEO, http://www.ncbi.nlm.nih.gov/projects/geo/). El análisis de expresión se realizó mediante la expresión Affymetrix consola (Affymetrix, Santa Clara, CA).

Análisis de datos

Los resultados de
in vitro
estudios se derivan de al menos tres independientes experimentos y analizaron con pruebas t de dos colas. Las diferencias en los histoscores entre dos grupos se compararon mediante la prueba t de Student. Los valores de p & lt dos colas; 0,05 se consideraron significativos. Los análisis estadísticos se realizaron con el paquete estadístico SPSS, versión 17.0 (SPSS Inc., Chicago, IL, EE.UU.).

Resultados

Los cánceres ováricos expresan niveles más altos de BAIAP2L1 que otros tipos de cáncer

Los 10 tumores de ovario especímenes estudiados compuesto de 6 cánceres malignos, 2 cistoadenoma seroso borderline (coordinar #E y N), y 2 leiomioma (coordenadas #F y J) (Fig 1A). También se determinaron otro tipo de cáncer ginecológico y de los tejidos normales de orígenes uterinas y cervicales. En los tres tipos de tejidos, BAIAP2L1 niveles de expresión en los tejidos tumorales fueron significativamente más altos que los tejidos normales. Del mismo modo, la expresión del ARNm de BAIAP2L1 en líneas celulares de cáncer de ovario fue mayor que las líneas de células normales (Fig 1B). De acuerdo con los resultados de expresión de ARN, la expresión de proteínas BAIAP2L1 es mayor en el cáncer de ovario que en los tejidos normales, como se muestra en FDA805-1and 805-2 arrays de tejido (Fig 2).

(A) La matriz de cáncer Profiling II (BD Clontech) de cDNA derivado de tejidos normales (N) y los tejidos tumorales (T) de ovario, útero y cuello uterino. La cuantificación del ARNm de tumor y los tejidos normales de diferentes sitios se muestran en el panel derecho. expresión BAIAP2L1 en los tumores fue significativamente mayor que en los tejidos normales (** P & lt; 0,01). (B) la expresión del ARN BAIAP2L1 en líneas celulares de cáncer de ovario fue mayor que las líneas de células normales. líneas de cáncer de ovario seroso incluyen el tipo (SKOV3), el tipo endometrioide (TOV112D, MDAH2774), y el tipo de células claras (TOV21G). HFL1 es celular de fibroblastos de pulmón humano normal, y T /G HA-VSMC es células de músculo liso de aorta humana normal.
abreviaciones
: T, tumor; N, normal.

Los resultados se derivan de arrays de tejidos disponibles comercialmente FDA805-1and 805-2, que contiene los órganos normales y tumores correspondientes (cuadros S2). El número entre paréntesis indica el número de casos en los arrays de tejido. La puntuación inmunohistoquímica general (histoscore) fue el porcentaje de células positivas multiplicado por su intensidad de la tinción (0 = negativo, 1 = débil, 2 = moderada, 3 = fuerte), y varió de 0 a 300 (100% multiplicado por 3).

tejidos de cáncer de ovario metastatizadas expresan BAIAP2L1 más altos que el cáncer primario

se analizaron los niveles de proteína de BAIAP2L1 en 193 tejidos de cáncer de ovario seroso, que contienen, endometrioide, de células claras y tipos de células mucinoso ( Fig 3). Los niveles de expresión de BAIAP2L1 no fueron diferentes entre los diversos tipos de células de cáncer de ovario, estadio y el grado de cada subtipo histológico, pero cada tipo de cáncer de ovario expresan BAIAP2L1 significativamente más altos que los tejidos ováricos normales (Fig 3). La expresión de BAIAP2L1 se analizó adicionalmente en 14 muestras apareadas de los cánceres de ovario primarios y sus correspondientes sitios de metástasis (Tablas S3). Los sitios metastásicos incluyen epiplón (n = 7), los ganglios linfáticos (n = 3), parametrio (n = 1), intestino delgado (n = 1), ciego (n = 1), y el cerebro (n = 1). Doce de los 14 pares tenían mayores expresiones BAIAP2L1 en los sitios de metástasis que en los tumores primarios (p & lt; 0,05). (Fig 4)

Se realizaron estudios de inmunohistoquímica en tejidos de cáncer de ovario (n = 193) y los controles normales (n = 20). El panel superior indica la intensidad de la tinción inmunohistoquímica (0 = negativo, 1 = débil, 2 = moderado, 3 = fuerte). La puntuación global de inmunohistoquímica (histoscore) fue el porcentaje de células positivas multiplicado por la intensidad de la tinción, con un rango de 0 a 300 (100% multiplicado por 3).

El panel superior muestra la expresión en un BAIAP2L1 par representativo de cáncer de ovario primario y su sitio de metástasis.

múltiples conjuntos de datos independientes validan sobre regulación de BAIAP2L1 en cáncer de ovario

Los datos en los datos GSE14407 ajuste [29] indicaron que BAIAP2L1 expresión mRNA fue significativamente mayor en las células epiteliales de cáncer de ovario (CEPI, 11.8 ± 0.28 se muestra como media ± error estándar) que en el epitelio superficial del ovario normal (OSE, 10,8 ± 0,22) (p = 0,004) (figura 5A). En el nivel de expresión de tejido, conjunto de datos GSE36133 mostró que BAIAP2L1 fue significativamente mayor en 182 cánceres primarios de ovario y de Falopio trompas (10,4 ± 0,09) en comparación con 1680 cánceres primarios en su mayoría de mama, colon, recto, endometrio, pulmón y riñón (9.8 ± 0,04) (p = 4,5 x 10
-7) (Fig 5B). conjunto de datos GSE2109 [30] reveló además que BAIAP2L1 fue significativamente mayor en 49 líneas celulares de cáncer de ovario (9,4 ± 0,17) que las líneas celulares de 972 de cáncer derivadas de otros tejidos (8,6 ± 0,07) (p = 0,004) (Fig 5C).

(A) los niveles de expresión de ARNm de BAIAP2L1 en las células epiteliales de cáncer de ovario (CEPI) aislados from12 adenocarcinoma seroso de ovario y el epitelio superficial del ovario (OSE) a partir de 12 ovarios humanos normales. Los datos se recuperan de GSE14407. (B) Los niveles de expresión de BAIAP2L1 en los tejidos de cáncer de ovario (OV, n = 182) y el cáncer de otros sitios primarios (n = 1680). Los datos se recuperan de GSE36133. (C) Los niveles de expresión de BAIAP2L1 en líneas celulares de cáncer de ovario (OV, n = 49) y de otros orígenes (n = 972). Los datos se recuperan de GSE2109.

La ausencia de fusión de genes entre FGFR y BAIAP2L1 en
cáncer de ovario
Ninguna de 8 a prueba ARN cáncer de ovario contenía la transcripción del gen de fusión entre FGFR y BAIAP2L1, mientras que el ARN de las células SW780 de cáncer de vejiga expresadas transcritos del gen de fusión (S2 Fig).

BAIAP2L1 no sólo promueve la proliferación celular sino que también previene la apoptosis en células de cáncer de ovario

Desde BAIAP2L1 se ha demostrado para promover la proliferación celular en el carcinoma hepatocelular (HCC) [22], también a prueba la función de BAIAP2L1 en el crecimiento celular de células de cáncer de ovario. Desmontables de BAIAP2L1 con (Figura 6A) La tecnología siRNA inhibe el crecimiento celular en varias líneas celulares de cáncer de ovario, que se muestra en los resultados de los ensayos de incorporación de BrdU (Fig 6B) y ensayos de MTT (Figura 6C).

BAIAP2L1 en dos el cáncer de ovario líneas celulares (MDAH2774 y SKOV3) se knockdowned con si-ARN (A) y se analizaron con (B) de ensayo BrdU incorportation y ensayo de MTT (C). (D) BAIAP2L1 caída en células SKOV3 aumento de escisión de caspasa 3 y PARP, que eran indicadores de apoptosis. Las células se irradiaron con UV (100 J /M
2) o se trataron con cisplatino 10 M durante 24 h para inducir la apoptosis. Para visualizar con claridad las intensidades diferenciales de bandas de PARP escindida, se utilizaron dos tiempos de exposición durante la quimioluminiscencia: largo (60 segundos) y corto (10 segundos). El nivel de actina se utilizó para normalizar la cantidad de proteína de entrada. análisis (E) cuantitativa de la caspasa 3 escindida y la PARP. Los resultados mostrados son la media ± error estándar de tres experimentos independientes. Los asteriscos denotan significación estadística (p & lt; 0,05).

En las vías de apoptosis, pro-caspasa 3 se activa y se escinde en 17 kDa y 12 kDa fragmentos, y luego enzima proteolítica digiere las proteínas aguas abajo, tal como poli (ADP-ribosa) polimerasa (PARP) [31]. Sin insultos de ADN (UV o cisplatino), desmontables de BAIAP2L1 solos niveles ligeramente elevados de PARP escindida (Figura 6D y 6E). Después de la irradiación UV o tratamiento con cisplatino durante 24 h, desmontables de BAIAP2L1 aumentó el nivel de proteína de la caspasa 3 escindida y PARP escindida. Estos resultados sugieren que BAIAP2L1 puede proteger las células de la apoptosis.

Discusión

expresión BAIAP2L1 se ha demostrado que aumenta en el carcinoma hepatocelular [22]. En este estudio, los análisis de la base de datos integral de BAIAP2L1 en GSE14407 y tejidos de cáncer de GSE36133, así como líneas celulares GSE2109 validar nuestros resultados de inmunohistoquímica de la expresión de alto BAIAP2L1 en los cánceres de ovario. Estos resultados indican, por primera vez, que BAIAP2L1 está regulada positivamente en el cáncer de ovario humano, que representa el aumento de la proliferación celular y la resistencia a la apoptosis de cáncer de ovario.

Nuestros resultados que histoscores BAIAP2L1 de sitios metastásicos son más altos que ovárica primaria cánceres sugieren que BAIAP2L1 puede contribuir a la invasión tumoral y la metástasis. Estos resultados están de acuerdo con los hallazgos de que BAIAP2L1 está involucrada en la deformación de la membrana plasmática y la remodelación del citoesqueleto de actina, que son importantes para la migración celular [20]. Aunque el gen del receptor de FGF oncogénico 3 (FGFR3) -BAIAP2L1 fusión ha sido identificado en los cánceres de vejiga cáncer [23] y de pulmón [24], no hemos podido detectar la transcripción de genes de fusión de BAIAP2L1 en este estudio de un número limitado de ejemplares. La presencia de la fusión de genes FGFR-BAIAP2L1 se ha demostrado para traducir una proteína más grande en otros tipos de cáncer [24], pero identificado BAIP2L1 sólo como una única banda de 57 kD en el análisis de transferencia Western de las células de cáncer de ovario, descartando la presencia de FGFR fusión -BAIAP2L1 gen.

BAIAP2L1 también se ha demostrado en la progresión de la enfermedad de la artritis reumatoide, donde la expresión BAIAP2L1 en las células sinoviales similares a fibroblastos se correlacionó positivamente con la proteína C reactiva (CRP), un marcador clínico común para inflamación [32]. Los niveles de PCR se han demostrado para predecir la supervivencia en pacientes con carcinoma de células renales, cánceres de vejiga y de próstata, y la incorporación de CRP en los modelos de pronóstico para esos tipos de cáncer mejora la precisión predictiva de los modelos [33]. Estos hallazgos apoyan colectivamente que BAIAP2L1 está implicada en la inflamación y la tumorigénesis en general [34].

Las funciones más concluyentes de BAIAP2L1 En mamíferos se ha revelado recientemente por el grupo de Han utilizando un enfoque de ratón knockout [35]. BAIAP2L1 actúa como un adaptador de receptor de insulina (IR) que activa la (sustrato del receptor de insulina 1/2) IR-IRS1 /2 -AKT vía de señalización a través de la estimulación de la fosforilación de tirosina de IR. ratones BAIAP2L1 deficientes muestran resistencia a la insulina y la glucosa homeostasis anormal [35]. Además, la expresión hepática de BAIAP2L1 se redujo en ratones y seres humanos con diabetes tipo 2, lo que sugiere una asociación entre BAIAP2L1 regulación a la baja y el desarrollo de diabetes. Curiosamente, la disminución hepática de BAIAP2L1 en pacientes diabéticos parecía tener una discrepancia entre hombres y mujeres, que los autores postularon que es causada por la insuficiencia de los tamaños de muestra [35]. A la luz de un estudio de asociación del genoma donde BAIAP2L1 está muy asociada con los niveles circulantes de la hormona sexual globulina de unión [36], una regulación dependiente de sexo de las funciones BAIAP2L1 sigue siendo digno de estudiar.

Además relacionada actina funciones de BAIAP2L1, que se explicitan principalmente de estudios bacterianos [16,17,18,19], el descubrimiento de BAIAP2L1 en las vías de IR-IRS-AKT pueden arrojar luz a su papel en el metabolismo específico del cáncer. Para proporcionar bloques de construcción para el crecimiento tumoral, las células cancerosas aumentan la síntesis de ácidos grasos y el metabolismo de la glutamina, a expensas de la utilización de la glucólisis aeróbica ineficiente [37]. Las concentraciones de glucosa en los tumores sólidos son generalmente más bajos que los tejidos normales [38], por lo que las células cancerosas a menudo anhelan glucosa y glutamina [39]. Los estudios futuros pueden demostrar que BAIAP2L1 está involucrado en conseguir más la entrada de glucosa a las células cancerosas, tal vez mediante el aumento de la eficiencia de los transportadores de Glut. Además, varios efectores aguas abajo de IR incluyen (i) MAPKs que se sabe que promueven la proliferación celular [22] y (ii) PI-3K que aumenta la síntesis de proteínas y ácidos grasos y evitar que las células cancerosas de la apoptosis [40].

Conclusiones

Los resultados de este estudio no sólo indican que BAIAP2L1 se puede utilizar como un biomarcador de cáncer de ovario humano, pero también revelan su papel en la biología del cáncer. Los estudios clínicos con gran número de muestras y ensayos cuantitativos serán necesarios para validar la utilidad de BAIAP2L1 en la práctica clínica. Aclarar en mayor medida el papel de BAIAP2L1 en el contexto de los efectores IR-IRS-aguas abajo vías de células cancerosas se justifica para el desarrollo de terapias contra el cáncer dirigidos metabolismo específico del cáncer.

Apoyo a la Información
S1 Fig. Los perfiles de mRNA de BAIAP2L1 en tejidos y líneas celulares
doi: 10.1371. /Journal.pone.0133081.s001 gratis (DOCX)
S2 Fig. La ausencia de gen de fusión entre el FGFR3 y BAIAP2L1
doi:. 10.1371 /journal.pone.0133081.s002 gratis (DOCX)
Cuadros S1. FDA matrices tisulares (805-1 y 2) y histoscores de BAIAP2L1
doi: 10.1371. /journal.pone.0133081.s003 gratis (DOC)
Tablas S2. matrices tisulares (BC 111109, 111110 aC, y OV8011-2-BX) y histoscores de BAIAP2L1
doi: 10.1371 /journal.pone.0133081.s004.
(DOCX)
S3 tablas. La información clínica de 14 casos de cáncer y histoscores de BAIAP2L1 en el cáncer de ovario primario y sitios de metástasis
doi:. 10.1371 /journal.pone.0133081.s005 gratis (DOCX)

Reconocimientos

los autores agradecen al Banco de Tumores, Chang Gung Memorial hospital y Jung-Erh Yang por su excelente asistencia técnica. Agradecemos al Dr. Su-Fang Lin de Investigación Nacional de Salud Institutos (Miaoli, Taiwan) para proporcionar el ARN total de las células SW780 y el Dr. T. Wang Shihtien (Departamento de Nefrología Pediátrica, Hospital Infantil de la Universidad de la Escuela Médica de Illinois en Chicago) para edición de Inglés. Este estudio fue apoyado por Chang Gung Médica Fundación:. CMRPG3E0391 (Chao A), CMRPG3C1621-2 (Tsai CL), CMRPG3C0281-3, CMRPG3C0941-2 y CRRPG3D0031 (Wang TH)

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]