Crónica enfermedad > Cáncer > artículos del cáncer > PLOS ONE: privación de suero induce DRAM Expresión en células de cáncer de hígado a través de modificaciones de las histonas dentro de su locus Promotor
PLOS ONE: privación de suero induce DRAM Expresión en células de cáncer de hígado a través de modificaciones de las histonas dentro de su locus Promotor

2016/3/8


Extracto

DRAM es una proteína de membrana lisosomal y es fundamental para la autofagia y apoptosis mediada por p53. DRAM tiene una función potencial-tumor supresor y es downregulated en muchos cánceres humanos. Sin embargo, la regulación de la expresión de DRAM está mal descrito hasta ahora. Aquí, hemos demostrado que la privación de suero induce fuertemente la expresión de DRAM en las células de cáncer de hígado y una secuencia de ADN del núcleo en el promotor de DRAM es esencial para su capacidad de respuesta a la privación de suero. Se observó, además, que los marcadores de eucromatina para transcripciones activo representado por diacetil-H3, tetra-acetil-H4 y la trimetil-H3K4 en la región núcleo promotor del gen de la DRAM son aparentemente aumentaron de una manera dependiente del tiempo a la privación de suero, y de forma concomitante la dimetil -H3K9, un marcador herterochromatin asociada con genes silenciados, fue dependiente del tiempo disminuyó. Por otra parte, el factor de remodelación de la cromatina BRG-1 está enriquecido en la región núcleo promotor del gen de la DRAM y es necesario para la expresión de la privación de suero DRAM inducida. Estas observaciones ponen las bases para una mayor investigación de la expresión génica DRAM

Visto:. Ni P, Xu H, C Chen, Wang J, Liu X, Hu Y, et al. (2012) Expresión privación de suero induce la DRAM en células de cáncer de hígado a través de modificaciones de las histonas dentro de su promotor Locus. PLoS ONE 7 (12): e50502. doi: 10.1371 /journal.pone.0050502

Editor: Austin John Cooney, Baylor College of Medicine, Estados Unidos de América

Recibido: 27 Marzo, 2012; Aceptado: 24 Octubre 2012; Publicado: December 12, 2012

Derechos de Autor © 2012 Ni et al. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que el autor original y la fuente se acreditan

Financiación:. Este trabajo fue apoyado por el Comité de Ciencia y Tecnología de Shanghai Metropolitana (11ZR1423100); la Fundación Nacional de Ciencias de China (otorgar No .: 30772233, 30873057 a Y. Lu, y 81.172.028 a la Z. Hou); Clave Proyecto Básico de Shanghai Municipal de Ciencia y Tecnología de la Comisión (No .: 08JC1413600); Shanghai Comité de Ciencia y Tecnología (11DZ2260200); y la Fundación Joint 985 Tumor. Los donantes no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión a publicar, o la preparación del manuscrito

Conflicto de intereses:.. Los autores han declarado que no existen intereses en competencia

Introducción

la inactivación de las vías de muerte celular es un componente central de la progresión del cáncer [1]. Existen varios mecanismos en células humanas normales para invocar la muerte celular y la erradicación de las células dañadas que pueden crecer de forma aberrante para formar tumores [2] - [4]. En condiciones macroautofagia normal (denominado en lo sucesivo como "la autofagia") es un proceso de membrana de la trata estrictamente regulados para degradar y el reciclaje de proteínas y orgánulos citosólicas a niveles basales. Puede ser inducida por encima del nivel basal en respuesta a diversos estímulos incluyendo el hambre de nutrientes, infección, agentes genotóxicos, o citoquinas [5] - [8]. La autofagia puede funcionar en diferentes contextos para promover o inhibir la supervivencia de las células [1], [5], [7], [9] - [11], lo que sugiere que puede jugar un papel patológico importante en la carcinogénesis

Human
DRAM
gen (daño reguladas autofagia modulador) se identificó como un gen p53 activada por que codifica una proteína de la membrana lisosomal altamente conservado y está constituido por 238 aminoácidos de longitud [12]. DRAM no sólo es crítica para la capacidad de p53 sobreexpresada o daño activado ADN p53 para modular la autofagia [13], sino también para la capacidad de p53 para inducir apoptosis [9]. La DRAM se localiza específicamente en los lisosomas, un orgánulo que participa en la última etapa de la autofagia [12]. Por lo tanto es plausible que DRAM puede regular la fusión autophagosome-lisosoma, un proceso necesario para la generación de autophagolysosomes.

Se ha demostrado que la DRAM tiene una función potencial-tumor supresor y es downregulated en muchos cánceres humanos [ ,,,0],12]. La regulación a la baja de DRAM ARNm en estas células de cáncer se produce tanto por hipermetilación directa dentro de la isla CpG en la región promotora de este gen y por otro, aún no identificados, los mecanismos tales como las modificaciones epigenéticas del núcleo de histonas cerca del gen DRAM [12]. En este informe, que caracteriza el promotor del gen humano DRAM e identificamos la secuencias de ADN esencial para su regulación.

Resultados

Suero hambre estimula la expresión de DRAM en las células de cáncer de hígado

Privación de suero induce la apoptosis y la autofagia en muchos tipos de células incluyendo las células HepG2 y HepB3. Estas observaciones nos llevó a examinar si la privación de suero podría inducir la expresión de DRAM en las células de cáncer de hígado. células HepG2 y Hep3B se cultivaron hasta 70% de confluencia en DMEM que contiene 10% de FBS. Estas células se lavaron con PBS tres veces y se alimentaron con medio de la omisión de FBS para varios períodos de tiempo. Se recogieron las células resultantes y se extrajeron los ARN totales. La expresión de mRNA DRAM se examinó por RT-PCR cuantitativa (QRT-PCR). En tanto en células HepG2 y Hep3B el mRNA de DRAM se indujo significativamente 24 h privación post-suero, y alcanzó el nivel más alto a las 48 h (Figura 1A, B) de una manera similar, lo que sugiere que la privación de suero induce la expresión de DRAM en las células de cáncer de hígado . El nivel de proteínas en las células HepG2 DRAM a varios tiempos se examinó mediante ensayos de Western blot. De acuerdo a la expresión de mRNA DRAM observado por qRT-PCR, la proteína DRAM se detectó débilmente a las 3 horas después de la privación de suero y llegó a alto nivel a las 24 y 48 horas de privación de suero (Figura 1C).

(A) el nivel de ARNm del gen DRAM sobre la privación de suero en diferentes puntos temporales fueron cuantificados por tiempo real de RT-PCR en células HepG2. (B) la expresión de DRAM en las células Hep 3B es similar a la observada en las células HepG2. (C) Análisis de la expresión de la proteína DRAM en las células HepG2. CD166 sirvió como control positivo para la privación de suero expresión de la proteína inducida. Las células fueron cultivadas a 70% de confluencia en DMEM que contiene 10% de FBS. Estas células se lavaron con PBS y se alimentaron con medio DMEM FBS omitiendo para varios puntos de tiempo. Se recogieron las células resultantes y se extrajeron los ARN totales y lisados ​​de células enteras y la expresión de ARNm y proteínas DRAM se examinó por qRT-PCR o transferencia Western. GAPDH se usa como control interno. (D) Inhibición de la síntesis de proteínas no afecta a la expresión DRAM inanición inducida por suero en las células HepG2. Las células se trataron con CHX (10 mM) bajo la privación de suero durante 24 horas, y el ARN total se extrajo para el análisis de la expresión DRAM por PCR en tiempo real. Todos los resultados se presentan como medias ± S.D.. de tres experimentos independientes. **,
p
. & Lt; 0,01 nivel usando la prueba t

Para determinar si se requiere nueva síntesis de proteínas para la privación de suero para inducir la expresión de DRAM, se aplicó la cicloheximida (CHX) a los medios libres de suero durante 30 minutos para inhibir la síntesis de proteínas nuevas. El pretratamiento de las células HepG2 con CHX no inhibió la expresión inducida por la privación de suero DRAM (Figura 1D), lo que sugiere que la regulación al alza de la expresión de DRAM es independiente de la síntesis de proteínas en las células HepG2.

La región proximal del promotor de DRAM es sensible a la digestión por nucleasa

para identificar los elementos reguladores que la respuesta a la privación de suero en el promotor de DRAM, que expone en primer lugar para determinar el sitio de inicio de transcripción (TSS) del gen mediante el empleo de DRAM 5 'RACE ensayos . La secuenciación de ADN confirmó que tres productos de PCR designados como producto 1 (~216 pb), el producto 2 (~172 pb), y el producto 3 (~106 pb) fueron amplificaciones directas de la 5 'UTR del gen de la DRAM (Figura 2A). La banda más baja (~47 pb) en el gel fue la amplificación no específica de los mismos cebadores. Los primeros nucleótidos para el producto 1, 2, y 3 se identificaron como A, T y A, respectivamente (Figura 2B). Producto 1 y el producto 2 fueron 65 pb y 20 pb aguas arriba, mientras que el producto 3 era 107 pb aguas abajo del primer nucleótido de la secuencia de ADNc de DRAM que se encuentra en el banco de genes del Centro Nacional de Información Biotecnológica (ID Gen: 728655). Para una descripción conveniente de aquí en adelante, nos referimos de forma arbitraria el nucleótido A en el producto 1 como el TSS (1).

(A) en gel de agarosa mostró múltiples productos de PCR 5 'RACE. (B) Cartografía del potencial de la TSS
DRAM gen
. La flecha indica el cebador 5 'RACE inverso anidado. El GeneRacer PCR, basada en ARN ligasa mediada y oligo-tapado rápida amplificación de cDNA, se llevó a cabo de acuerdo con las instrucciones del fabricante. Los productos de PCR se resolvieron en gel de agarosa, y se recogieron y se confirmaron por secuenciación de ADN bandas potenciales. * Indica una amplificación no específica de los dimmers de imprimación.

Para proporcionar más pistas en búsqueda de los elementos reguladores en el promotor de DRAM, hemos realizado ensayos TABLA-PCR para evaluar la accesibilidad del promotor DRAM ADN para nucleasa digestión. Núcleos aislados de HepG2 y células Hep 3B se sometieron a digestión con ADNasa I o MNase y los resultantes fragmentos de ADN genómico entre -7216 y + 289 pb (con relación a la ubicación de TSS) se analizaron usando ensayos de PCR cuantitativa (figura 3A). Los datos se presentaron como el percentil entre el ADN intacto de las muestras tratado con nucleasa y la no tratada, y se reflejaron inversamente la proporción de la ADN protegido. Los fragmentos de ADN que abarca el promotor proximal (R5, R6 y R7) eran más sensibles a la ADNasa I y la digestión MNase, con particular R6 (-144 a 72) que presenta la protección más bajo de ~ 35% tanto en las células examinadas, mientras que una mayor se observaron niveles de protección contra la DNasa I o la digestión MNase en la R1 y R2 de la región, lo que indica que la DNasa I y accesibilidad MNase se limitan a la región promotora proximal, sobre todo a la región R6 (Figura 3B).

(a) representación esquemática de los conjuntos de cebadores utilizados para la carta-PCR. región (B) R6 del promotor DRAM es más sensible a ADNasa I y la digestión MNase. El ADN genómico se aisló a partir de células Hep 3B y HepG2 y se analizó por PCR cuantitativa. Los datos se muestran como porcentaje de ADN digeridos a los ADN digeridos. (C) Suero privación aumenta la accesibilidad de las regiones R5, R6 y R7 nucleasa digestión en células Hep 3B y HepG2.

Para examinar el efecto de la privación de suero sobre la accesibilidad de ADN del promotor DRAM a DNasa I y la digestión MNase, núcleos aislados de células HepG2 y Hep3B cultivadas en medio libre de suero durante 48 horas se sometieron a digestión con nucleasa y análisis gráfico-PCR. La accesibilidad de todas las regiones R5, R6 y R7 a la digestión por nucleasa se aumentó significativamente tanto en las células a la privación de suero con la región R6 presentan el nivel mínimo de protección (Figura 3C). En conjunto, estos datos implican que la región proximal del promotor de DRAM contiene cis-regulador putativo elementos de respuesta a la privación de suero.

inanición de suero induce cambios en la modificación de las histonas en el loci promotor DRAM

Para más reforzar la observación de que la región proximal del promotor de DRAM contiene cis-regulador putativo elementos a la privación de suero, se analizó el estado de modificación de histona en este locus utilizando los ensayos de chip. acetilaciones histonas tales como la acetilación de la lisina en H3 y H4 se conocen generalmente a asociarse con los genes transcritos activamente y estructura de la cromatina abierta [14] - [16]. Se utilizaron anticuerpos específicos para H3 diacetilado (K9 y K14) y tetra-acetilada H4 (K5, K8, K12 y K16) para realizar el análisis de chips para determinar el patrón de modificaciones de las histonas en el promotor DRAM locus con o sin suero. En las células Hep 3B tanto H3 y H4 fueron acetilados en la región R1, R6 y R7, R6 con el locus que muestra el nivel más alto de acetilación. La acetilación de histonas fue aparentemente aumentó de una manera dependiente del tiempo a la privación de suero en las regiones R6 y R7, pero los ensayos no la región R1 (Figura 4A, B)

Hep3B se prepararon las células para IP de la cromatina (ChIP) . Los ADN de la cromatina se inmunoprecipitaron con anticuerpos específicos para H3K4me3 (A), anti-di-acetil-H3 (B), anti-H3K9me2 (C) y anti-tetra-acetil-H4 (D), y los fragmentos de ADN enriquecidos que flanquea el promotor DRAM se analizaron por PCR cuantitativa. Los datos se presentan como la cantidad de ADN recuperado por anticuerpos específicos relativos al ADN enriquecido por los controles de IgG adecuadas. Los resultados se expresaron como la media ± desviación estándar de tres experimentos independientes. *: P & lt; 0,05

A continuación, se examinó el estado de metilación de las histonas en el locus del promotor de DRAM.. El trimetil-H3K4, un marcador euchromatic [17] - [18], muestra un patrón similar con diacetil-H3 y Tetra-acetil-H4 en células Hep3B (Figura 4C), mientras que la dimetil-H3K9 se anotó más bajo en la región de R6 en nivel basal y se disminuyó junto con la privación de suero prolongada (Figura 4D). El dimetil H3K9 sirve como una señal para el silenciamiento de la cromatina mediante la contratación de las proteínas HP1 (proteína heterocromatina 1) y es mutuamente excluyente con H3-K9 acetilación [19]. En conjunto, estas observaciones indican que la activación de la transcripción del gen de la DRAM se correlaciona con un aumento de los marcadores de euchromatic locales y de forma concomitante disminución de marcadores heterocromáticos.

NF-kappa B no es responsable de la activación del promotor de DRAM

Para identificar los elementos reguladores mínimos a la privación de suero en el promotor de DRAM, diversos fragmentos del promotor proximal DRAM se insertaron en el vector aguas arriba del indicador de luciferasa de luciérnaga. Las actividades transcripcionales de estas construcciones se ensayaron en células Hep3B y HepG2. El reportero que contiene el fragmento -1741 /+ 299 solamente respondió débilmente a suero privación, mientras que los reporteros que contiene -863, -75, 19 /+ 299 fragmentos muestran actividades significativas en alta luciferasa sensible a la privación de suero. Sorprendentemente, el informador que contiene el fragmento de + 28 /+ 299 no muestran actividad a suero privación (Figura 5A). Estos datos indican que los elementos reguladores cis a la privación de suero en el promotor DRAM se residían la región flanqueante -19 /+ 28 nucleótidos (Figura 5B). El reportero de promotor que contiene el fragmento de ADN más corto que abarca -19 /+ 28 región fue nombrado como Luc-DCP en lo sucesivo.

células (A) Hep3B y HepG2 se transfectaron transitoriamente con plásmidos informadores que contienen versiones truncadas de la región promotora de
DRAM
gen como se indica. Luc-DCP se define como el indicador que contiene la región del promotor más corto (-19~ + 28). (B) La región del promotor de núcleo contiene un sitio de unión de NF-kappa B putativo. factor de transcripción sitios presentados en la región promotora de núcleo (-19~ + 28) de unión se basa por TFSEARCH software web y MatInspector y los plásmidos mutación o deleción fueron generados utilizando el método de mutagénesis dirigida al sitio. (C) La mutación o deleción del sitio de unión de NF-kB no afecta a la actividad del promotor de núcleo.

En un esfuerzo para buscar el potencial factor de transcripción sitios de unión en -19 /+ 28 región, nos Seguidamente, realizó el análisis bioinformático integral y encontró un sitio NF-kB de unión canónica residió en esta región. Para confirmar si este sitio NF-kB de unión putativo es funcional, hicimos deleción y mutación en este sitio (Figura 5B). Sorprendentemente, la deleción o mutación de este sitio NF-kappa B-unión no tenían efecto aparente sobre la actividad del promotor en sensible a la privación de suero (Figura 5C). Estos datos sugieren que otros factores, no se requiere NF-kB de memoria DRAM inducción por privación de suero.

Los componentes clave de la compleja maquinaria de transcripción se unen a la región proximal del promotor DRAM

Brg I y ARN polimerasa II son los principales componentes de la ARN polimerasa II holoenzimas que participan en la transcripción de genes [20]. La cromatina de las células Hep 3B y HepG2 fueron cosechadas y se precipitó con anti-Brg I y II anticuerpos anti-Pol. Los ADN precipitados fueron evaluados por PCR en tiempo real. Brg I obligado más que el ADN en la región R6 tanto en las células, mientras que Pol II unido a las regiones R6 y R7 con mayor afinidad que la de la región R4 (Figura 6A). Sorprendentemente, la privación de suero resultó en un aumento de la unión de Brg I y Pol II del ADN en la región R6 y se ve tan pronto como 5 minutos después de la privación de suero tales aumentos y alcanzó el nivel más alto a los 30 minutos en ambas células, respectivamente (Figura 6B).

(a) BRG-1 se une a la región proximal del promotor de DRAM. Chip ensayos se realizaron en células Hep 3B y HepG2. (B) la privación de suero mejora BRG-1 y Pol II unión al locus promotor DRAM. (C) El agotamiento de BRG-1 utilizando shRNA expresión específica de orientación suprime la privación de suero inducida DRAM.

BRG-1 es necesaria para la inducción de la privación de suero de expresión DRAM

Para examinar el papel de Brg I en la inducción de la expresión de DRAM, las células HepG2 fueron transfectadas con siRNA oligos específicamente contra BRM o Brg I durante 24 h, seguido de ensayos de RT-PCR (Figura 6c, panel izquierdo). La inducción de la expresión DRAM por la privación de suero fue abolida por el agotamiento de Brg I. Sin embargo, desmontables de BRM no afectó la expresión de DRAM (Figura 6C). Estos resultados demuestran que BRG-I es esencial para la inducción de DRAM sensible a la privación de suero.

Discusión

DRAM tiene una función potencial supresor de tumores y es crítica para p53 para modular la autofagia y apoptosis [ ,,,0],12]. Por lo tanto, el descubrimiento de los factores reguladores que gobiernan la expresión DRAM proporcionará objetivos para nuevas terapias. Sin embargo, la regulación de la expresión de DRAM está mal descrito hasta ahora. Aquí, hemos demostrado por primera vez que la privación de suero fuertemente inducida por la expresión de DRAM en las células HepG2 y Hep3B cáncer de hígado y se identificó una secuencia de ADN en el promotor del núcleo de DRAM, que es esencial para su capacidad de respuesta a la privación de suero.

Anteriormente DRAM se identificó como un gen p53 inducida y un elemento de respuesta p53 funcional se encuentra en 2,3 kb aguas arriba del promotor DRAM [21]. Aquí, hemos demostrado que la privación de suero induce la expresión DRAM en HepG2, una célula positiva p53, y Hep3B, una p53 células negativas de una manera similar, lo que sugiere p53 no puede ser un factor clave que interviene en esta inducción [22]. Sin embargo, se trata de un gran interés para ver si hay algún tipo de cooperación entre la privación de suero p53and en la regulación de la expresión de DRAM.

Nuestros datos muestran que el fragmento más largo (-1714) débilmente respondió a la privación de suero. Postulamos que en el fragmento más largo existen elementos cis represivas que podría disminuir la actividad basal de promotor de DRAM. La versión corta del promotor no contiene tales elementos, y mostrar una alta actividad transcripcional

La acetilación y metilación de residuos de lisina de las histonas básico colas son críticos para la transcripción de genes [23] -. [24]. Acetilaciones de lisinas en H3 y H4 se conocen generalmente a asociarse con los genes transcritos activamente y estructura de la cromatina abierta [15] - [16], [25]. Consistentemente, se observó que en las células Hep3B y HepG2 acetilación de lisina en H3 y H4 fue aparentemente aumentó de una manera dependiente del tiempo a la privación de suero en la región núcleo promotor del gen de la DRAM. El trimetil H3K4, un marcador eucromática para la transcripción activa, muestra un patrón similar con diacetil-H3 y tetra-acetil-H4 en células Hep3B. En contraste, el dimetil-H3K9 se anotó más bajo en la región de R6 a nivel basal y era dependiente del tiempo se redujo a la privación de suero. El dimetil H3K9 sirve como una señal para el silenciamiento de la cromatina mediante la contratación de las proteínas HP1 y es mutuamente excluyente con H3-K9 acetilación. Estos datos sugieren que la privación de suero puede inducir montaje cooperativo de acetiltransferasas de histonas desacetilasas, y metiltransferasas, complejo transcripcional de la cromatina objetivo de modificar los códigos de histonas. Sin embargo, no tenemos claro cual modificadores de histonas son reclutados para este locus. Curiosamente, se observó que los cambios en represiva a marcas de histona activos se llevan a cabo en los primeros 15 minutos, y no cambian significativamente en absoluto hasta las 24 horas, mientras que el ARNm de DRAM se aumenta gradualmente y alcanza el nivel superior hasta que a las 24 horas y 48 horas. Esta aparente retardo de la expresión de mRNA DRAM puede ser debido al tiempo para el montaje de la maquinaria de transcripción para conducir de manera eficiente la expresión de genes DRAM. Sin embargo, el mecanismo exacto necesita ser aclarada. Actualmente, estamos tratando de identificar los posibles complejos de proteínas que podrían unirse a esta secuencia de ADN del núcleo mediante telecine ADN y espectrometría de masas enfoques y ha identificado varias proteínas, incluyendo p300 que pueden potencialmente unirse al promotor del núcleo de DRAM. Su papel en la regulación de la expresión de DRAM están siendo interrogados a fondo.

El supresor de tumores BRG-1 es un componente central de la SWI /SNF remodelación de cromatina complejo [26]. Este complejo puede activar la transcripción de genes por la remodelación de la estructura de la cromatina en las interacciones ADN-histonas perturbadores en los nucleosomas. Hemos demostrado que BRG-1 está enriquecido en la región núcleo promotor del gen de la DRAM y se requiere para la expresión inducida por la privación de suero DRAM.

La proteína BRM (Brahma) puede sustituir BRG-1 y cumplir la helicasa /ATPasa función del complejo in vitro. Sin embargo, BRG-1 y BRM no son funcionalmente intercambiables en vivo. Homocigotos
Brg1
knockout embriones mueren antes de la implantación y ratones heterocigotos son propensos a desarrollar tumores epiteliales [26] - [27], mientras que
BRM
knockouts son viables y no desarrollan tumores [28] - [29]. Consistentemente, el agotamiento de BRG-1 en las células HepG2 abolido la privación de suero indujo la expresión DRAM, mientras que el agotamiento de BRM no afectó la expresión de DRAM. BRG-1 se ha demostrado que desempeñan un papel clave en la regulación de la apoptosis y la autofagia celular, pero los mecanismos que sirven de fundamento son oscuros. Identificación de DRAM es un objetivo directo de BRG-1 va a arrojar nueva luz sobre la regulación molecular de la autofagia.

Materiales y Métodos

Cultivo celular, transfección y plásmidos

HepG2 y células Hep 3B (ATCC) se mantuvieron en DMEM que contiene 10% de FBS (Gibco), 2 mM L-glutamina, y penicilina (50 U /ml) /estreptomicina (50 mg /ml) a 37 ° C bajo 5% de CO
2 en una cámara húmeda.

las células transfección se realizó utilizando el Lipofectamine 2000 (Invitrogen Corp, Carlsbad, CA, EE.UU.) según las instrucciones del fabricante. Los oligos siRNA dirigidos específicamente BrgI (CGCGCUACAACCAGAUGAATT), BRM (GGAUUGUAGAAGACAUCCATT) o un control negativo (scramble ARN, UUCUCCGAACGUGUCACGUTT) fueron adquiridos (GenePharma Co., Ltd, Shanghai, China).

PCR transcripción reversa (RT-PCR )

el ARN total fue extraído utilizando el reactivo Trizol (Invitrogen). La mezcla de reacción (20 l) que contiene 1 g de ARN total se transcribió de forma inversa en ADNc en el uso de RT-PrimeScript polimerasa (Takara). Los ADNc resultantes se analizaron usando (Sistema Mx3000P IME-real PCR, Stratagene, La Jolla, CA, EE.UU.) mediante PCR cuantitativa con pares de cebadores específicos para DRAM y GAPDH. Los datos se presentan como proporciones del total de los niveles de mRNA de DRAM contra β-actina.

5'-RLM-RACE

El sistema de GeneRacer (Invitrogen), basado en ARN ligasa mediada y oligo -capping rápida amplificación de cDNA, se llevó a cabo de acuerdo con las instrucciones del fabricante. El kit asegura la amplificación de sólo transcripciones de larga duración mediante la eliminación de mensajes truncados desde el proceso de amplificación. primers específicos DRAM (F, TGCGAAACGAGTGAAGTCACAAAGC; R, GCGAGCTCCAAGCGGACGCGACTAC) fueron utilizados para la amplificación por PCR utilizando el sistema LaTaq rica en GC PCR (Takara, Inc., Dalian, China)

análisis de la accesibilidad de la cromatina
.
accesibilidad del ADN a se analizaron mediante la accesibilidad de la cromatina a través de TABLA dE-PCR como se describe anteriormente digestión DNasa I y MNase (Takara, Inc., Dalian, china) [30] - [31]. Los ensayos se repitieron tres veces de forma independiente. Los pares de cebadores para las diferentes regiones como sigue: R1 (F: TCCAACCCTCATGGATGGCTTTTAG; R: ATTCAGTCACATCTTCAGGCTCTAC); R2 (F: ATGAATCAGTAGTAGGGCACGAAAG; R: CAGCCTGGTCAACAGATAGAG); R3 (F: TTGCGGGTCTCACTATATTGTCCAG, R: GGGCAGACTAGTATTTCAAGAGATC); R4 (F: TCCAGAACACAAATCCCTTTCACAG, R: GAGCCTTTATCACACCACTTCACTC); R5 (F: CGCTCTCCTGGAAAGCAGCACAATG, R: AGTGTTCAATGAGGTTCGCCAGGTC); R6 (F: ACCTCATTGAACACTTCTGCCCGAC; R: GCTCTTGCGCAACTCTGGAGAAAAG); R7 (F: CGAGTGTCCAAACCAAAAGCGAAAG; R: TGCGAAACGAGTGAAGTCACAAAG).

inmunoprecipitación de cromatina (CHIP)

Chip ensayos se realizaron de acuerdo con las instrucciones del fabricante (Active Motif, Carlsbad, CA, EE.UU.). Las proteínas de ADN complejos se inmunoprecipitaron con 4 mg anticuerpos ARN polimerasa II (SC-9001, Santa Cruz Biotechnology), y Brg1 (SC-10768); dimetil-H3-K9 (ab1220, Abcam), tetra-acetil-H4 (06-866, Upstate) y diacetil-H3 (07-593, Upstate); y trimetil-H3-K4 (9751, Cell Signaling Technology). En tiempo real las reacciones de PCR se realizaron por triplicado con 1 l de ADN precipitado. DNA recuperado de las muestras que contienen un anticuerpo se comparó con los controles de IgG realizados en partes alícuotas de la misma preparación de la cromatina. Los datos se presentan como la cantidad de ADN recuperado con respecto al control IgG apropiado proporcionado por los fabricantes. Los resultados se expresaron como la media ± desviación estándar de tres experimentos independientes.

Construcción de los plásmidos informadores de luciferasa promotor-DRAM y el ensayo de luciferasa

ensayos de PCR se realizaron utilizando conjuntos de cebadores específicos de la
DRAM
promotor (F-1714): AGGAACGCGTACTCCACGGCCACAGTGATCTCTTG; F (-863): TGGAACGCGTGGCCACATATGTTGGGCTCAGACTC; F (-75): TGACACGCGTGGTGGCCACTCTCACTGCTGCGAAG; F (-19): TGACACGCGTTCGGGGTGCGAGGCCCGGCACTC; F (+28): TGACACGCGTGTTGGGAGAAATAAATCCTTTTCTC; R (299): CGTACTCGAGCGGGCTTGTTGCGAAACGAGTGAAG). Estos productos de PCR se clonaron en los sitios Mlu I /Xho I del vector pGL3-Basic (Promega, Madison, WI, EE.UU.). mutaciones y deleciones del promotor se generaron mediante un kit de mutagénesis dirigida al sitio basada en PCR (Takara), utilizando el plásmido correspondiente, como las plantillas. Para la sustitución de nucleótidos y la supresión del promotor mínimo, una secuencia de ADN de ocho nucleótidos GCGCGCGC se utilizó para reemplazar el ADN de tipo salvaje en el promotor mínimo, o el núcleo sitio de unión de NF-kB se eliminó utilizando el método de mutagénesis dirigida a sitio. plásmidos informadores Promotor se transfectaron transitoriamente en las células usando Lipofectamine 2000 (Invitrogen). PTRL-TK plásmido (Promega) se co-transfectadas como control interno para evaluar la eficiencia de la transfección. Veinticuatro horas después de la transfección, se recogieron las células resultantes y se preparó para el análisis de la actividad de luciferasa. Las actividades de luciferasa se midieron utilizando el sistema Dual-Luciferase reportero de ensayo (Promega) de acuerdo con el protocolo del fabricante con la iluminómetro (PerkinElmer Life Sciences, Boston, MA, EE.UU.).

Análisis Western Blot

Las células se recogieron y se lisaron en tampón RIPA (Beyotime Inc.). Los lisados ​​celulares se clarificaron por centrifugación a 15.000 g durante 10 min. 20 g de las proteínas totales se resolvió el 8% en geles de SDS-PAGE. Las proteínas se transfirieron electroforéticamente a una membrana Immobilon P (Millipore). Las transferencias Western fueron descritas anteriormente [32]. La anticuerpos DRAM (AP1825a, Abgent) y β-actina (SC-130656, Santa Cruz Biotechnology) se adquirieron.

El análisis estadístico

Las evaluaciones estadísticas se realizaron utilizando la prueba t. & lt valores-P;.. 0,05 fue considerado estadísticamente significativo

Reconocimientos

Agradecemos al Dr. Kevin M. Ryan para compartir el plásmido DRAM

El conocimiento de la salud

Mi primer Relevo por la Vida para ayudar a combatir Cancer

Our equipo se llama El cáncer de Foxgate club de la lucha.

Louis Vuitton sac Un notable baja equidad y dela

una notable baja equidad y retrasar una onda normalmente Lou

Nuevo virus que causa el cáncer oral Found

nuevo virus que causa el cáncer oral Encontrado Hay una n

Enfermedades de sentido común

Enfermedad del corazón | Enfermedades artículos | Enfermedad pulmonar | las preguntas más frecuentes de salud | Salud mental | Diabetes | El sentido común de la Salud | Enfermedades comunes | senior Health | Primeros auxilios
Derechos de autor © Crónica enfermedad[www.enfermedad.cc]